Labshake search
Citations for Promega :
1301 - 1350 of 3617 citations for Mouse NBL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were lysed and luciferase activity assayed using a luciferase assay kit (Promega) as described in the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... and purified twice with a miniprep kit (PureYield™ Plasmid Miniprep System, Promega). Plasmids were eluted with RNase free water and used as templates for in vitro gene expression (E ...
-
bioRxiv - Developmental Biology 2022Quote: ... followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega). Quantitative PCR was performed by using the Agilent Mx3000P qPCR system with the 2×SYBR Green qPCR Master Mix (Bimake) ...
-
bioRxiv - Immunology 2021Quote: ... Cartridges were further washed with Rapid digestion buffer (Promega, Rapid digestion buffer kit) and bound proteins were subjected to on-column digestion using mass spec grade Trypsin/Lys-C Rapid digestion enzyme (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... the mycelium DNA was extracted with the Maxwell RSC Plant DNA Kit (Promega) on the Maxwell RSC Instrument (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: The luciferase assay was performed with the Dual-Glo Luciferase Assay Kit (Promega) following the protocol in ref ...
-
bioRxiv - Plant Biology 2019Quote: ... Total RNA was extracted using the Maxwell 16 Lev Plant RNA Kit (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... cheiranthoides plant using Wizard® Genomic DNA Purification Kit (Promega, Madison WI, USA). The quantity and quality of genomic DNA was assessed using a Qubit 3 fluorometer (Thermo Fisher ...
-
bioRxiv - Bioengineering 2019Quote: ... the NanoLuc signal was measured using a Nano-Glo Luciferase assay kit (Promega) and a plate reader system (molecular devices) ...
-
bioRxiv - Microbiology 2019Quote: Glycosyltransferase activity was evaluated using GDP- or UDP-GloTM Glycosyltransferase Assay kits (Promega) with GDP-mannose (VA1095 ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was removed by using the RQ1 DNase kit (Promega, Madison, Wisconsin, USA). DNA and RNA were quantified fluorimetrically using Quant-iT PicoGreen and Quant-iT RiboGreen (both Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: ADP formation was measured using an ADP-Glo kinase assay kit from Promega in a 384-well solid white microtiter plate ...
-
bioRxiv - Molecular Biology 2020Quote: ... and luciferase assays were performed using the Dual-Luciferase Reporter Assay Kit (Promega), read out on a Turner Biosystems Modulus Microplate luminometer ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Maxwell® RSC Blood DNA Kit (cat# AS1400, Promega, Madison, WI, USA) respectively ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA samples were then purified using the Wizard SV PCR purification kit (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Genetics 2020Quote: DNA was isolated from spleen using the Wizard Genomic DNA Purification Kit (Promega) according to the manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2020Quote: The RNA was transcribed to cDNA using M-MLV reverse transcription kit (Promega) following the manufacturer’s recommendations using a defined amount of RNA (1μg for bees and 50 ng for mites ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Genomic DNA was extracted with the DNA extraction IQ™ System kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: RNA was extracted from organoids using the Simply RNA Tissue kit (Promega, AS1340) on the Maxwell RSC 48 instrument (Promega) ...
-
bioRxiv - Genetics 2019Quote: ... cells were lysed and assayed for luciferase activity (Luciferase reporter assay kit, Promega). Luminescence in relative light units (RLU ...
-
bioRxiv - Microbiology 2021Quote: ... 35 and 42 were extracted with Wizard® Genomic DNA purification kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... was measured using the Caspase-Glo-3/7 kit ((Promega, Madison, WI, USA). The luminescence assay was measured using Biotek Synergy H1 microplate reader (Biotek ...
-
bioRxiv - Bioengineering 2021Quote: ... was measured using the RealTime-Glo MT Cell Viability kit (Promega, Catalog #G9711). Both measures were repeated for three separate wells ...
-
bioRxiv - Molecular Biology 2021Quote: ... The fragments excised from the gel purified by the DNA Purification kit (Promega) according to the maker instructions.
-
bioRxiv - Biochemistry 2020Quote: ... Luciferase activity was then measured using a commercial dual luciferase assay kit (Promega), after which firefly luciferase activity was normalized to Renilla activity and the values for the control groups were set to one.
-
bioRxiv - Biochemistry 2020Quote: ... viability was measured using the CellTiter-Glo 2.0 Cell Viability Assay kit (Promega) in the same conditions.
-
bioRxiv - Plant Biology 2021Quote: ... APOLO was transcribed using the T7 transcription kit (Promega; (Ariel et al., 2020)) ...
-
bioRxiv - Neuroscience 2020Quote: ... and luciferase signals were measured with Dual-Glo® Luciferase assay kit (Promega) using GENios pro plate reader (Tecan) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the luciferase assay was performed using Dual-Luciferase Reporter Assay System kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... TUNEL staining on tissue sections was performed using the DeadEnd™ kit (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2020Quote: Assessed using Cell Titer-Glo Luminescent Viability Assay kit (Promega Corporation, Madison, WI).
-
bioRxiv - Neuroscience 2019Quote: ... briefly genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega) and digested with the XbaI restriction enzyme (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... luciferase activity was measured with a Dual-luciferase reporter assay kit (Promega, USA).
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted using the Wizard DNA Purification kit (Promega, Madison, Wisconsin) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted using the SV Total RNA Isolation kit (Promega, Wisconsin, USA). RNA was DNase treated using the Turbo DNase kit (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Bioluminescence generated by Gaussia luciferase was measured using the Renilla luciferase kit (Promega) on a FLUOstar Omega plate reader (BMG Labtech) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard® Genomic DNA Purification Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... Santiago-089 was extracted using the Wizard genomic DNA purification kit (Promega, USA) and sequenced at MicrobesNG (University of Birmingham ...
-
bioRxiv - Molecular Biology 2021Quote: ... Yeast genomic DNA was isolated using a Wizard Genomic DNA Purification Kit (Promega) and digested with XhoI ...
-
bioRxiv - Molecular Biology 2020Quote: ... we used the CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted using a Maxwell 16 Cell DNA Purification Kit (Promega). Genomic DNA libraries were prepared using a Nextera XT kit (Illumina ...
-
bioRxiv - Pathology 2021Quote: ... Total RNA extraction was performed using the SV RNA Isolation System Kit (Promega), following the manufacturers’ recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... Cytotoxicity was quantified colorimetrically with the CytoTox96 lactate dehydrogenase (LDH)-release kit (Promega). The percentage of cytotoxicity was calculated with the formula ...
-
bioRxiv - Microbiology 2021Quote: ... and genomic DNA was isolated using the Wizard Genomic DNA Purification Kit (Promega). qPCR reactions of 10 µL were set up with 5 µL PowerUpTM SYBRTM Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified using GoTaq® 1-Step RT-qPCR kit (Promega). SARS-CoV-2 N gene RNA was amplified using forward (Ngene F cgcaacagttcaagaaattc 28844-28864 ...
-
bioRxiv - Microbiology 2020Quote: ... and chromosomal DNA was prepared using the Wizard Genomic DNA Purification Kit (Promega).
-
bioRxiv - Cancer Biology 2020Quote: Cell viability was determined by CellTiter 96 aqueous one solution proliferation kit (Promega) and/or CellCountingKit-8 (CCK-8 ...
-
bioRxiv - Cell Biology 2021Quote: ... using a CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega, USA). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... The luciferase activities were measured utilizing the luciferase reporter assay system kit (Promega).