Labshake search
Citations for Promega :
1251 - 1300 of 2354 citations for ssc mir 15a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... PCR genotyping was conducted using GoTaq® Green Master Mix (Promega) in a Bio-Rad T100 thermal cycler ...
-
bioRxiv - Plant Biology 2020Quote: ... After initial cloning of the PCR amplificate into pGEM-T (Promega), the coding sequence was excised with BamHI/EcoRI and ligated downstream of the His tag into the multiple cloning site MCS1 of pETDuet-1 (ampicillin resistance ...
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed using GoTaq® Colorless Mastermix (Promega, Madison, USA), 0.4 μM of each primer and 2 μL DNA ...
-
bioRxiv - Cell Biology 2021Quote: PCR was performed using GoTaq DNA polymerase (Promega, Fitchburg, WI, USA) according to the manufacturer’s guidelines with the following primers for eEF2 (AGGTCGGTTCTACGCCTTTG ...
-
bioRxiv - Immunology 2022Quote: ... PCR products were cloned using pGEM®-TA cloning kit (Promega) and sequenced with T7/SP6 universal primers ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR fragment was subcloned into pmiR-GLO reporter vector (Promega) at the SacI and XbaI restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs were amplified by 15 PCR using GoTaq G2 polymerase (Promega) and TruSeq_adaptor_fwd and TruSeq_adaptor_rev primers (Table S1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Q-PCR reactions were performed using GoTaq qPCR Master Mix (Promega) in a CFX96 Real-Time System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Genomic DNA for PCR genotyping with GoTaq® Green Mastermix (Promega) and Sanger sequencing was then extracted using QuickExtract™ DNA Extraction Solution (Lucigen) ...
-
bioRxiv - Microbiology 2021Quote: ... in the dNTPs used for the PCR (GoTaq DNA polymerase, Promega). The fixed membrane was incubated overnight at 68°C in presence of the hybridization probes and revealed using a biotin chromogenic detection kit (K0661 ...
-
bioRxiv - Molecular Biology 2020Quote: The coupled Transcription/Translation system (T7 Quick for PCR DNA, Promega) was used to express ATFS-1 from a PCR template ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... These PCRs were performed using the GoTaq G2 DNA mastermix (Promega) for 30 cycles with 30s at 95°C denaturation ...
-
bioRxiv - Pathology 2022Quote: ... Reverse transcription PCR was performed using GoScript Super-Mix (Promega, USA), and RT-qPCR was performed using SYBR Green Super-Mix (Bimake ...
-
bioRxiv - Cancer Biology 2019Quote: ... Experiments using PCR were performed using GoTaq Hot Start Polymerase (Promega) according with manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR products were cloned into the pGEM-T Easy vector (Promega) and six clones per individual were sequenced with Templi-Phi DNA Sequencing Template Ampflication Kit (Amersham Biosciences).
-
bioRxiv - Genomics 2019Quote: ... PCRs were carried out using GoTaq® G2 DNA Polymerase (Promega) generally based on the suppliers’ protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR amplification products were cloned into the PGEMT vector (Promega) and inserted into E ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR fragments were cloned into the pGEM-T Easy vector (Promega) and sequenced for both strands ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products were cloned into the luciferase pNL1.1 vector (Promega) and verified by sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... Successful clones were screened by colony PCR using GoTaq polymerase (Promega) and sequenced by Sanger sequencing (Genewiz Inc. ...
-
bioRxiv - Neuroscience 2019Quote: ... Firefly luciferase coding sequence was PCR amplified from pGL3 vector (Promega) with primers containing restriction sites for BamHI and NotI ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was PCR amplified with Promega GoTag green mastermix (Promega #M7123). PCR amplicon sizes for CRKL ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA was PCR amplified with Promega GoTag green mastermix (Promega #M7123). Surveyor was performed using IDT Surveyor kit (IDT #706020 ...
-
bioRxiv - Microbiology 2020Quote: ... The reagents used for PCR were obtained from Promega (Madison, WI) and a total volume of 25 μl reaction mixture for PCR amplification was carried out ...
-
bioRxiv - Neuroscience 2020Quote: ... The PCR reaction was performed with the GoTaq Green Mastermix (Promega) in a total volume of 50 µl in the presence of 0.2 µM of each oligo ...
-
bioRxiv - Microbiology 2021Quote: ... PCR reactions were done using 12.5 μL Master Mix 2X (Promega), 1.25 μL DMSO ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μl of 2× GoTaq q-PCR master mix (Promega, USA) and 0.6 μM of AF77/78 or AF79/80 primer pairs targeting a region close to the Cori or to the terminus (ter) ...
-
bioRxiv - Developmental Biology 2019Quote: ... A 30 cycle PCR amplification was performed with GoTaq polymerase (Promega) with the following conditions ...
-
bioRxiv - Genetics 2020Quote: ... the PCR product were cloned into the pGEM-T vector (Promega) and sequenced with M13 reverse primer ...
-
bioRxiv - Genetics 2021Quote: ... allowing us to screen F1’s by PCR (Promega GoTaq mastermix) followed by restriction digests with AflII (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... Colony and screening PCRs were performed using GoTaq DNA polymerase (Promega; supplemented with 10% DMSO when screening B ...
-
bioRxiv - Developmental Biology 2020Quote: ... The resulting PCR product was digested with NotI (Promega, Cat#R6431) and XbaI (Promega ...
-
bioRxiv - Developmental Biology 2020Quote: ... This was purified using a PCR clean up kit (Promega, A9281). The sgRNAs were synthesized using the MEGAscript™ T7 Transcription Kit (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR reactions were performed using Gotaq Flexi DNA polymerase (Promega) and equipment Mastercycler Nexus41 of Eppendorf ...
-
bioRxiv - Microbiology 2020Quote: ... and analytic PCRs were performed using MasterMix (Promega, Madison, Wisconsin, USA) or Green MasterMix (BioTools ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was cloned into a pJET1.2 cloning vector (Promega) and further subcloned into the pYES2 yeast shuttle vector between BamH1 and Xba1 sites.
-
bioRxiv - Evolutionary Biology 2021Quote: ... gel-purified (Wizard SV Gel and PCR Clean-Up System, Promega) and blunted using PfuUltra HF DNA polymerase (Agilent Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR products were ligated into pGEM-T easy (Promega, Madison, WI), excised by restriction enzyme digest ...
-
bioRxiv - Immunology 2020Quote: The PCR amplicon was cloned into a pGEMT easy vector (Promega) and then transformed into XL10-Gold ultracompetent bacteria (Agilent Technologies) ...
-
bioRxiv - Immunology 2020Quote: ... Real-time PCR was performed with the GoTaq qPCR Mastermix (Promega) using the CFX-96 real-time PCR System (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR product was purified with a purification kit (Promega, USA), and then sequenced by the dideoxy termination reaction using an AB3130 DNAxl sequencer ...
-
bioRxiv - Immunology 2021Quote: ... before kit purification (SV Gel and PCR Clean up System, Promega) and ligation in presence of T4 ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... from mouse genomic DNA and PCR products cloned into pGL4.23 (Promega) pre-digested with XhoI and HindIII using Cold Fusion Cloning kit (System Biosciences) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR product was subcloned in pGEMT Easy (Promega, Madison WI). This construct is referred as pGEMT-Npr3 (Bae et al. ...
-
bioRxiv - Microbiology 2022Quote: ... PCR was performed using GoTaq® Green (Promega, Madison, WI, USA), according to the manufacturer’s protocol for RT ...
-
bioRxiv - Microbiology 2022Quote: ... Quantitative PCR was performed using the GoTaq qPCR SYBR mastermix (Promega) on a LightCycler 480 instrument (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... qRT-PCR was performed with GoTaq qPCR Master Mix (Promega, A6002) and a Quantstudio5 Real-Time PCR Detection System (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative PCR was performed using GoTaq qPCR Master Mix (Promega, #A6001) with primers:
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative PCR (qPCR) was performed using GoTaq qPCR Master Mix (Promega). The primers used for Lrp6 were ...
-
bioRxiv - Microbiology 2023Quote: ... The final PCR product was inserted into pGEM- T Easy (Promega), generating plasmid pPfRh5_C-term_LoxP ...