Labshake search
Citations for Promega :
1251 - 1300 of 5335 citations for hsa mir 185 Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... the amount of input virus was normalized to the HiBiT value measured by Nano Glo HiBiT lytic detection system (Promega, Cat# N3040)] ...
-
bioRxiv - Microbiology 2022Quote: ... the amount of pseudoviruses prepared was quantified by the HiBiT assay using a Nano Glo HiBiT lytic detection system (Promega, Cat# N3040) as previously described32,57 ...
-
bioRxiv - Plant Biology 2023Quote: The protoplast samples with the HiBiT tag were analyzed using a Nano-Glo® HiBiT Lytic Detection System (Promega Corp., Madison, WI). As per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... The amount of produced pseudovirus particles was quantified by the HiBiT assay using Nano Glo HiBiT lytic detection system (Promega, Cat# N3040) as previously described14 ...
-
bioRxiv - Bioengineering 2024Quote: Ten microliters of supernatant from all the above reactions were incubated with 10 µl of freshly prepared UDP nucleotide detection reagent (Promega, Cat#: V6961) according to the manufacturer’s specifications ...
-
Exploring the interspecific interactions and the metabolome of the soil isolate Hylemonella gracilisbioRxiv - Microbiology 2022Quote: ... gracilis 16S rRNA PCR was performed from grown colonies in a 50 μl PCR-GoTaq™ green master mix (Promega Corp. Madison, USA cat# M712). For 16S rRNA gene amplification the following primers were used ...
-
bioRxiv - Plant Biology 2020Quote: ... corniculatus plants was synthesized from 3 μg of total RNA using a Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT) (Promega, WI, USA) and 100 pmol of random hexamers (Pharmacia Biotech) ...
-
bioRxiv - Biochemistry 2020Quote: ... Moloney murine leukemia virus reverse transcriptase (MMLV-RT) enzyme and recombinant RNasin® ribonuclease inhibitor were purchased from Promega (Madison, WI, USA). Evagreen 2X qPCR MasterMix was purchased from Applied Biological Materials Inc ...
-
bioRxiv - Microbiology 2020Quote: ... for gram-negative bacteria and cDNA library preparation was performed using the GoTaq® 2-Step RT-qPCR System (A6010, Promega, USA). The RT-PCR was done using the Applied Biosystems™ 7500 Real-Time PCR System and primers shown in the supplementary data table S2 (35-38) ...
-
bioRxiv - Immunology 2021Quote: ... Luminescence was read after 2 minutes shaking on an orbital shaker and 10 min incubation at RT using the GloMax instrument (Promega, Madison, USA).
-
bioRxiv - Plant Biology 2022Quote: ... cDNAs were synthesized from 1.5 μg of total RNA with oligo(dT) primers using Moloney Murine Leukemia Virus Reverse Transcriptase MMLV-RT according to the manufacturer’s instructions (Promega, Madison, WI, USA). RT-qPCR was carried out in a Chromo4 system (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... the buffer was diluted with 50 mM ABC to a final of 2M urea and digested overnight at RT with 1 µg trypsin (Promega, Walldorf, Germany). On the next day ...
-
bioRxiv - Microbiology 2024Quote: ... followed by reverse transcription to complementary DNA (cDNA) using 30 enzyme units(U) of the Moloney Murine Leukemia Virus reverse transcriptase (MMLV-RT) (Promega, WI, USA). The extension products were then analysed using the ABI3730xl DNA Analyzer (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viability was assessed at various time points by using the CellTiter-Glo Luminescent Cell Viability assay (Promega) following the manufacturer s guidelines ...
-
bioRxiv - Microbiology 2020Quote: ... At the indicated time points growth media was removed and 10 μl Beta-Glo (Promega, Madison, Wisconsin) was added per well ...
-
bioRxiv - Cell Biology 2022Quote: ... After 18h incubation time cell viability was measured by adding 20 μl CellTiter-Glo 2.0 Reagent (Promega). Luminescence signals of the CellTiter-Glo assay were detected on the EnVision 2104 Multilabel plate reader (PerkinElmer) ...
-
bioRxiv - Cell Biology 2022Quote: ... Trapped proteins were washed four times with methanol TEAB buffer followed by overnight Trypsin (1 μg, Promega) digestion at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The Nluc and BRET signals were measured (integration time: 1 s) after auto-injecting either Fz (Promega) or FFz (Promega ...
-
bioRxiv - Plant Biology 2020Quote: ... the PCR products were cloned into pGEM-T Easy plasmid (Promega) for propagation and sequencing (GATC Biotech ...
-
bioRxiv - Cell Biology 2020Quote: ... the PCR products were cloned into the pGEM-T vector (Promega). Sequencing of the inserts from a dozen of subclones in each case allowed us to ascertain the edits in TMEM70 exons ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR products were subcloned into the pGEM-T Easy vector (Promega) and the inserts were sequenced.
-
bioRxiv - Developmental Biology 2021Quote: ... The PCR products were inserted into pGEM-T Easy vector (Promega). Sequences encoding the full length and parts of Tdrd3 were cloned into pCS2-Flag-N or pCS2-Flag-C to produce Tdrd3 fused with Flag at the N- or C-terminus of Tdrd3 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The nested PCR products were cloned into pGEM-T vector (Promega) and the nucleotide sequence was determined by Sanger sequencing ...
-
bioRxiv - Genetics 2019Quote: ... (2003) using the GoTaq® PCR Core System I (Promega, USA). The following primer sequences were used ...
-
bioRxiv - Neuroscience 2021Quote: ... site-directed mutagenesis was performed using PCR with Pfu polymerase (Promega; mutagenesis primers 5’ to 3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR was performed using GoTaq G2 (M7845, Promega, Madison, WI, USA) according to manufacturer’s instructions with the primers Dsg2-W2A for ...
-
bioRxiv - Cell Biology 2021Quote: ... Qualitative PCR was performed with GoTaq® qPCR Master Mix (Promega) and a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2021Quote: ... purified using Wizard SV Gel and PCR Clean-Up System (Promega), and all 4 reactions were pooled together ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR amplicon obtained was ligated to pGEM-T Easy vector (Promega). Competent cells E ...
-
bioRxiv - Neuroscience 2020Quote: ... qRT-PCR was performed using the GoScriptTM Reverse Transcription System (Promega) and a C1000 Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were cloned using the pGEM-T Easy System (Promega) and sequence determined by Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Plant Biology 2021Quote: ... PCR genotyping was conducted using GoTaq® Green Master Mix (Promega) in a Bio-Rad T100 thermal cycler ...
-
bioRxiv - Plant Biology 2020Quote: ... After initial cloning of the PCR amplificate into pGEM-T (Promega), the coding sequence was excised with BamHI/EcoRI and ligated downstream of the His tag into the multiple cloning site MCS1 of pETDuet-1 (ampicillin resistance ...
-
bioRxiv - Microbiology 2021Quote: ... PCRs were performed using GoTaq® Colorless Mastermix (Promega, Madison, USA), 0.4 μM of each primer and 2 μL DNA ...
-
bioRxiv - Cell Biology 2021Quote: PCR was performed using GoTaq DNA polymerase (Promega, Fitchburg, WI, USA) according to the manufacturer’s guidelines with the following primers for eEF2 (AGGTCGGTTCTACGCCTTTG ...
-
bioRxiv - Neuroscience 2022Quote: ... The PCR fragment was subcloned into pmiR-GLO reporter vector (Promega) at the SacI and XbaI restriction sites ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs were amplified by 15 PCR using GoTaq G2 polymerase (Promega) and TruSeq_adaptor_fwd and TruSeq_adaptor_rev primers (Table S1) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Q-PCR reactions were performed using GoTaq qPCR Master Mix (Promega) in a CFX96 Real-Time System (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Genomic DNA for PCR genotyping with GoTaq® Green Mastermix (Promega) and Sanger sequencing was then extracted using QuickExtract™ DNA Extraction Solution (Lucigen) ...
-
bioRxiv - Microbiology 2021Quote: ... in the dNTPs used for the PCR (GoTaq DNA polymerase, Promega). The fixed membrane was incubated overnight at 68°C in presence of the hybridization probes and revealed using a biotin chromogenic detection kit (K0661 ...
-
bioRxiv - Molecular Biology 2020Quote: The coupled Transcription/Translation system (T7 Quick for PCR DNA, Promega) was used to express ATFS-1 from a PCR template ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... These PCRs were performed using the GoTaq G2 DNA mastermix (Promega) for 30 cycles with 30s at 95°C denaturation ...
-
bioRxiv - Pathology 2022Quote: ... Reverse transcription PCR was performed using GoScript Super-Mix (Promega, USA), and RT-qPCR was performed using SYBR Green Super-Mix (Bimake ...
-
bioRxiv - Cancer Biology 2019Quote: ... Experiments using PCR were performed using GoTaq Hot Start Polymerase (Promega) according with manufacturer’s instruction ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... PCR products were cloned into the pGEM-T Easy vector (Promega) and six clones per individual were sequenced with Templi-Phi DNA Sequencing Template Ampflication Kit (Amersham Biosciences).
-
bioRxiv - Genomics 2019Quote: ... PCRs were carried out using GoTaq® G2 DNA Polymerase (Promega) generally based on the suppliers’ protocol ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR amplification products were cloned into the PGEMT vector (Promega) and inserted into E ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR fragments were cloned into the pGEM-T Easy vector (Promega) and sequenced for both strands ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products were cloned into the luciferase pNL1.1 vector (Promega) and verified by sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... Successful clones were screened by colony PCR using GoTaq polymerase (Promega) and sequenced by Sanger sequencing (Genewiz Inc. ...