Labshake search
Citations for Promega :
1251 - 1300 of 1897 citations for Recombinant Human CLEC11A Protein T7 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were resolved in reducing and non-reducing SDS-PAGE gels and membranes were incubated overnight at 4°C with the following antibodies: rabbit polyclonal anti-human p75 intracellular domain (1:1000, Promega); mouse monoclonal anti-HA (1:2000 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 3.6 kbp human CDC37 promoter region was PCR amplified and subcloned into a pGL3-luciferase vector (Promega, Madison, WI) using KpnI and BamHI ...
-
bioRxiv - Genomics 2019Quote: To generate recombinant p53 we in vitro transcribed/translated human p53 with a c-terminal HA tag using a rabbit reticulocyte system (Promega). To generate fragmented genomic DNA we tagmented 50ng of human genomic DNA from MCF7 cells using the MuSeq kit (Thermo ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human NOCT (1-431) or Schistosoma japonicum GST coding sequences were inserted into pFC3F using the Flexi Cloning System (Promega). To generate NOCT Δ(2-15)-3F ...
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Immunology 2020Quote: ... pCAG-Flag or pCMV-HA-N expression vectors using standard molecular cloning methods as described in our previous publications.30–32 The IFN-β luciferase reporter plasmid pGL3-IFN-β-Luc vector was constructed in our previous study.33,34 The IFNλ1 luciferase reporter plasmid pGL3-IFNλ1-Luc was constructed by inserting the 1000-bp promoter region of human IFNλ1 (nucleotides −1000 to +1, with the translation start site set as 1) into pGL3-Basic (Promega, USA) according to methods outlined in previous studies.13,34 The ISG luciferase reporter plasmid pISRE-Luc vector was purchased from Clontech (USA) ...
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Molecular Biology 2023Quote: The sequences of wild-type (WT) F8 exons and 100-250 nucleotides flanking each exon were amplified from human genomic DNA (Promega) using WT PCR primers shown in Supplemental Table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Genetics 2024Quote: Regulatory elements were amplified by PCR from human genomic DNA using primers listed in Supplementary Table 10 and cloned into the pGL4.23 Luciferase Reporter Vector (Promega, E8411) linearized with NheI and EcoRV (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Plant Biology 2019Quote: ... In the next step proteins were digested overnight using 100 ng/µl trypsin (Promega) at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins bound to streptavidin-sepharose matrix were digested with trypsin (Promega, Madison, WI, USA) during 16 h or eluted for western blot analysis ...
-
bioRxiv - Genetics 2021Quote: The in vitro protein translations were performed using the TNT-assay (L4610) from Promega according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Tryptic digestion of proteins was carried out using porcine trypsin (Promega, GmbH, Mannheim, Germany). Trypsin solution prepared in 100 mM Ambic and 1 mM CaCl2 at a 0.01 μg/μl concentration and 100 μl added onto each sample for a final concentration of ~1.2 μg trypsin per sample containing 30 μg of total protein (trypsin to sample ration 1:25) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The proteins were digested in 1 M urea with modified trypsin (Promega, Madison, WI) at a 1:50 enzyme-to-substrate ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested with Lys-C (Wako Chemicals) overnight and trypsin (Trypsin Gold, Promega) for 6 hours.
-
bioRxiv - Molecular Biology 2020Quote: ... Protein pellets were resuspended in 8 M urea buffer combined with protease inhibitor (Promega) and purified using the chloroform-methanol precipitation method (Wessel & Flügge ...
-
bioRxiv - Biophysics 2022Quote: ... The purified Kif5B protein was incubated with 10 µM HaloTag PEG-Biotin ligand (Promega) for 30 min on ice to produce a final construct of Kif5B homodimer with two C-terminal biotin tags ...
-
bioRxiv - Cancer Biology 2019Quote: Proteins were digested with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA) by using filter-aided sample preparation methods[13] ...
-
bioRxiv - Immunology 2020Quote: ... IgG was purified from culture supernatant using Magne Protein A beads (Promega, Madison, WI) and the elution buffer exchanged with PBS using Amicon Ultra centrifugal filters (Millipore-Sigma ...
-
bioRxiv - Immunology 2021Quote: Proteins were in-gel digested with sequencing grade modified trypsin (Promega GmbH, Walldorf, Germany) similar to the procedure described by Pandey et al ...
-
bioRxiv - Neuroscience 2020Quote: ... samples containing 100 μg total protein were mixed with 100 μl Luciferase Substrate (Promega). The kinetics of the luminescence was recorded for 10 min using a TriStar2 S LB 942 Plate Reader (Berthold Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... The proteins were digested overnight at 37°C with Sequencing Grade Modified Trypsin (Promega) and the reaction was stopped by acidification ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested overnight at 37 °C by addition of 3 μg trypsin (Promega) and 2 μg LysC (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: Proteins were synthesized using TNT® SP6 Quick Coupled Transcription/Translation system (Promega L2080) using the standard reaction mix (rabbit reticulocyte lysate plus amino acids ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested for 18 h at 37°C with 0.5 μg trypsin (Promega). After digestion ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were digested for 18 hours at 37 °C with trypsin/LysC mix (Promega) at a protein-to-protease ratio of 25:1 ...
-
bioRxiv - Systems Biology 2020Quote: ... Proteins were digested for 18-24 hours on beads with sequencing grade trypsin (Promega) in 50 mM HEPES buffer at 1:50 trypsin to protein ratio for frozen tumors and 2 μg trypsin per 10 μm section of FFPE ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were digested at 37 °C overnight with trypsin (Promega; 1:10, enzyme/substrate) in the presence of 10% acetonitrile ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein extract was digested with trypsin (Catalog No. V5280, Promega, Madison, WI, USA) (trypsin ...
-
bioRxiv - Biophysics 2021Quote: Some protein kinase assays were performed using the ADP-Glo™ assay kit (Promega), which measures the generation of ADP in a kinase reaction ...