Labshake search
Citations for Promega :
1251 - 1300 of 1349 citations for 6 oxopiperidine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed for the splicing analysis with the 3 µl of cDNA in a total volume of 20 µl with GoTaq Polymerase 2X (Promega) and 32 amplification cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2024Quote: ... PAT-PCR was performed using a 3′ UTR-specific forward primer and a PAT universal primer with GoTaq Green Master Mix (Promega). The PCR products were separated by 6% PAGE in 0.5× TBE ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and mutant Shank2 and Mdga1 3′ UTR luciferase constructs were generated by standard cloning procedures into pmiRGLO dual-luciferase expression vector (Promega). First ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase3/7 activity was quantified in cell lysates using the Kit Caspase-Glo® 3/7 Assay Systems (G8091, Promega).
-
bioRxiv - Cell Biology 2023Quote: The Human SART1 mutant resistant to siSART1#3 and its deletions mutants (amplified by PCR) were subcloned into pCI-neo Mammalian Expression Vector (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... was added to 3 of the wells per treatment condition and 50 µL Oxidized Glutathione Lysis Reagent (Promega Cat #TM344) was added to the other 3 wells per treatment condition ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PC-3 cell line was authenticated by Macrogen (Korea) using short tandem repeat (STR) profiling (Powerplex 21 System, Promega). All cell lines tested negative for mycoplasma contamination using the Microsart AMP Mycoplasma Kit (Sartorius).
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... The caspase-3/7 activity of the lysates or the plated cells was analysed using Apo-ONE ® Homogenous Caspase-3/7 Assay (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were transfected with 700 ng of plasmid construct (PIB/V5_Gr9) and 3 μl of FuGENE® HD transfection reagent (Promega, USA) in 100 μl of medium per well ...
-
bioRxiv - Cancer Biology 2020Quote: CellTiter 96 AQueous One Solution Cell Proliferation Assay MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was used according to the manufacturer’s protocol (Promega, Madison, WI) to assess proliferation of cells cultured in 96-well plates.
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Physiology 2022Quote: A DNA fragment corresponding to partial f5 or f3a cDNAs was amplified from ovarian cDNAs by PCR using the gene-specific primers (see Supplemental Table 3 for detail) (28) and cloned into the pGEM-T Easy vector (Promega, USA). Correct sequence and orientations of inserts were validated by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... Remaining ATP was readout after 3 h incubation using Kinase-Glo® Luminescent Kinase kit following manufacturer’s instructions (Promega, WI, USA).
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
bioRxiv - Cancer Biology 2022Quote: ... These cells were transfected with the pcDNA6.2-GW /EmGFPmiR plasmids containing miR sequences (miR-NRF2 #1, #2, #3, #4 and miR-ctl 79 using the FUGENE HD transfection reagent (Promega #E2311). Seven days later GFP positive cells were isolated by flow cytometry (Biorad S3e cell sorter) ...
-
bioRxiv - Cell Biology 2021Quote: ... of miR-148a putative binding sites reporter plasmids were constructed using the circMRPS35 and 3’-UTR of STX3 sequences in the psiCHECK2 vector (Promega, USA). For IRES activity analysis ...
-
bioRxiv - Cell Biology 2020Quote: Transfections were carried out with 1 μg of total DNA (500 ng for each construct or with empty expression plasmid) and 3 μl of FuGENE ® HD Transfection Reagent (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: The cell viability of Vero E6 and Calu-3 cells was analyzed by quantification of ATP levels using the CellTiter-Glo™ Luminescent Cell Viability assay (Promega) according to the instructions of the manufacturer ...
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Molecular Biology 2022Quote: Cell death by apoptosis was measured using Caspase-Glo 3/7 luminescent assay system kit according to the manufacturer’s instructions (Promega Madison, WI). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... the coding sequence of RE02 extended by BsaI cleavage sites (Supplementary Table 3) was cloned into the pGEM®-T vector (Promega). The cauliflower mosaic virus 35 promoter ...
-
bioRxiv - Microbiology 2022Quote: Activity of caspases-3/7 and -8 were assessed using the corresponding Caspase-Glo® Assays in white-walled 96-well plates (Promega).
-
bioRxiv - Biochemistry 2023Quote: 10 μL in vitro nLuc mRNA translation reactions were performed in the dynamic linear range using 3 nM mRNA (31) in the Flexi Rabbit Reticulocyte Lysate (RRL) System (Promega # L4540) with final concentrations of reagents at 20% RRL ...
-
bioRxiv - Cell Biology 2023Quote: ... proteins were generated with pCS2-N-terminal 5×MYC vectors and pCS2-N-terminal 3×HA vectors described above using TnT® Coupled Reticulocyte Lysate System under the SP6 promoter (L4600, Promega) and by following manufacturer’s recommendations with few modifications ...
-
bioRxiv - Molecular Biology 2023Quote: 10 μL in vitro translation reactions were performed in the linear range using 3 nM mRNA in the Flexi Rabbit Reticulocyte Lysate (RRL) System (Promega # L4540) with final concentrations of reagents at 30% RRL ...
-
bioRxiv - Zoology 2024Quote: ... The amplicon target was amplified from WNV cDNA using the qPCR primers with the forward primer flanked by T7 sequence (5’-TAATACGACTCACTATAGGGATTCGGGAGGAGACGTGGTA-3’) and transcribed using T7 RiboMAX Express Large Scale RNA Production System kit (Promega, France). RNA was purified by ethanol precipitation ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... drugs were added to plates in triplicate and incubated for 3 days before being developed by adding CellTiterGlo (Promega, Madison, WI) per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: The short TMEM106B 3’ UTR and the long TMEM106B 3’ UTR were amplified from human genomic DNA (H1) and then cloned into the pmirGLO Dual-Luciferase Vector (Promega, E1330) using Gibson assembly ...
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: SMC5/6 hexamer purified from E.coli with a C-terminal HALO tag on Nse2 was incubated with a 2-fold molar excess of Janelia-Fluor646 HaloTag Ligand (Promega; 12 µM Smc5/6 hexamer + 24 µM label). After incubation for 1 h at 25°C ...
-
bioRxiv - Plant Biology 2020Quote: ... corniculatus plants was synthesized from 3 μg of total RNA using a Moloney Murine Leukemia Virus Reverse Transcriptase (MMLV-RT) (Promega, WI, USA) and 100 pmol of random hexamers (Pharmacia Biotech) ...
-
bioRxiv - Cancer Biology 2021Quote: ... DNA:FuGENE complexes were formed at a ratio of 1:3 (μg DNA/μL FuGENE HD) according to the manufacturer’s protocol (Promega, Madison, WI, USA). The resulting transfection complex (1 part ...
-
bioRxiv - Genomics 2021Quote: ... Cells were then grown for 3 days at which point the viability was measured using a CellTiter-Glo assay (Promega Cat# G9241) read out on a standard luminometer ...
-
bioRxiv - Biochemistry 2020Quote: ... or PACAP (10 nM final) and assayed 3 hours later with the Nano-Glo® Dual-Luciferase® Reporter System (Cat# N1630; Promega) on a Berthold Sirius luminometer to quantify ERK activation.
-
bioRxiv - Biophysics 2020Quote: ... P1KO cells were transiently transfected in a 6-well plate (the cells were seeded 8 h before transfection) in the presence of ruthenium red (10 μM) and mouse Piezo1 (3 μg) using Fugene6 (Promega, Madison, WI). 20–30% of cells showed positive GFP expression indicating successful Piezo1 transfection.