Labshake search
Citations for Promega :
1251 - 1300 of 1509 citations for 6 methoxypyridine 3 4 diamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The transfected neurons were stimulated with 200μM glycine for 3 min and then washed for 30 minutes before lysis in 100 μl of buffer for dual luciferase assay (Promega). 20 μl of the lysates were used for the quantification of Firefly and Renilla Luciferase activity using a Luminometer (GloMax ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were cultured for 3 days and cell viability was measured using CellTiter-Glo® 3D Cell viability assay (Promega) according to the manufacturer’s protocol ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 70 μL of a 50/50% mixture containing PBS and the Caspase-Glo 3/7 reagent (Promega). Lysates were incubated at least 2 hours protected from the light at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... PCR was performed for the splicing analysis with the 3 µl of cDNA in a total volume of 20 µl with GoTaq Polymerase 2X (Promega) and 32 amplification cycles ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Neuroscience 2023Quote: Wild-type and mutant Shank2 and Mdga1 3′ UTR luciferase constructs were generated by standard cloning procedures into pmiRGLO dual-luciferase expression vector (Promega). First ...
-
bioRxiv - Cell Biology 2023Quote: The Human SART1 mutant resistant to siSART1#3 and its deletions mutants (amplified by PCR) were subcloned into pCI-neo Mammalian Expression Vector (Promega).
-
bioRxiv - Cancer Biology 2023Quote: Caspase3/7 activity was quantified in cell lysates using the Kit Caspase-Glo® 3/7 Assay Systems (G8091, Promega).
-
bioRxiv - Cell Biology 2023Quote: ... was added to 3 of the wells per treatment condition and 50 µL Oxidized Glutathione Lysis Reagent (Promega Cat #TM344) was added to the other 3 wells per treatment condition ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Molecular Biology 2024Quote: ... PAT-PCR was performed using a 3′ UTR-specific forward primer and a PAT universal primer with GoTaq Green Master Mix (Promega). The PCR products were separated by 6% PAGE in 0.5× TBE ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PC-3 cell line was authenticated by Macrogen (Korea) using short tandem repeat (STR) profiling (Powerplex 21 System, Promega). All cell lines tested negative for mycoplasma contamination using the Microsart AMP Mycoplasma Kit (Sartorius).
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Cancer Biology 2019Quote: 293T cells were transfected with pSpCas9(BB)–2A–Puro:sgRNA #4 (0.5 μg) using the FuGENE HD Transfection Reagent (Promega). Two days after transfection ...
-
bioRxiv - Genomics 2020Quote: ... We removed RNA species in the nucleic acid via the addition of 4 μg of RNase A (Promega), and incubation at 37°C for 1 hour ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 4 hours after plating cells were transfected with 1μg of histone H3.3-HaloTag®Fusion Vector DNA (Promega) + 0.1 μg of NSD2 PWWP1-NanoLuc® Fusion Vector DNA (C-terminal ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by the secondary antibody for 1 h at +4 °C (anti-rabbit IgG-HRP, Promega 65-6120). The Pierce® enhanced chemiluminescence substrate (Thermo-Fischer Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Systems Biology 2022Quote: ... followed by 4-fold dilution and an overnight digestion with 500 ng trypsin (Promega, Charbonnieres les Bains, France). Peptide mixtures were then desalted on C18 spin-column and dried on Speed-Vacuum.
-
bioRxiv - Microbiology 2019Quote: ... The cells were fixed with 4% paraformaldehyde for 5 min and permeabilised with 0.2 % Triton X-100 (Promega) in PBS for 10 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... ATP solution (5 μL of a 100 μM solution containing 0.1 μg 4:1 glycine:tyrosine peptide substrate (Promega)) was added and incubated at 37 °C for 20 min before the addition of ADP-Glo reagent (5μL ...
-
bioRxiv - Microbiology 2021Quote: ... Cells (100 μL) were then incubated with 4 μM cheopin or Fast Break lysis solution (Promega, Madison, WI) and absorbance at 405 nm was measured for 1h using a BioTek Synergy H1M plate reader set to 28°C.
-
bioRxiv - Biophysics 2021Quote: ... Proteins were then trypsin digested as follows: initially for 4 hours with 1.5 μl trypsin (0.5 μg/μl; Promega) and then another 2 hours with 0.5 μl additional trypsin ...
-
bioRxiv - Genomics 2020Quote: ... each of the wells containing 0.5 μl of lysis solution (0.2% Triton X-100 [Roche], 0.8 units of RNasin Plus [Promega], 4 mM dNTPs [Promega] and 1 μM of barcoded oligo-dT primers [E3V6NEXT ...
-
bioRxiv - Microbiology 2020Quote: ... In-gel digestion was performed by adding 25 μL of 4 μg/mL sequencing grade modified trypsin (Promega) in 25 mM ammonium bicarbonate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Dry gel pieces were digested with 200 μL of mass spectrometry-grade trypsin solution (4 ng/μL, Promega) in AMBIC and incubated at 37°C for 18 h ...
-
bioRxiv - Genetics 2022Quote: ... Transfection efficiency was determined in parallel by preparing transfection mixes containing 4 μl FuGENE HD transfection reagent (Promega), 96 μl Opti-MEM (Life Technologies) ...
-
bioRxiv - Microbiology 2023Quote: ... The fluorescently labeled PCR products were digested by using the 4-bp cutter TaqI (Promega, Southampton, United Kingdom) as described by the manufacturers ...
-
bioRxiv - Plant Biology 2023Quote: ... Transcripts of interest were amplified using designed primers (Supplementary Table 4) and cloned into pGEMT-Easy vector (Promega). Digoxigenin-labelled antisense and sense RNA probes were transcribed from T7 or SP6 promoter of pGEMT-Easy vector (Promega ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:4 with 50 mM Tris/HCl (pH 8.0) and sequencing grade modified trypsin (Promega) was added in an enzyme-to-substrate ratio of 1:50 ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA was isolated from 4-day-old wild-type seedlings using a Maxwell RSC Plant Kit (Promega). cDNA was synthesized from total RNA (100 ng ...
-
bioRxiv - Cancer Biology 2023Quote: ... and their numbers were measured every 2–4 days using the CellTitre-Glo 3D cell viability assay (Promega), as described by the manufacturer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ligation of the digested pGEM-T easy vector and 5’ fragments was carried out overnight at 4 °C using 0.5 µl (1.5 U) of T4 DNA Ligase (Promega). pGEM-T easy vector containing the 5’ fragment (5’-pGEM-T ...
-
bioRxiv - Cancer Biology 2021Quote: MAGI2-AS3 or FOXN3 3’UTR containing miR-452-5p wild-type (WT) or mutant (MUT) binding sites were inserted into psiCHECK vector (Promega, USA). 293T cells were transfected with the constructed luciferase plasmid together with miR-NC or miR-452-5p mimics using Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2020Quote: ... The caspase-3/7 activity of the lysates or the plated cells was analysed using Apo-ONE ® Homogenous Caspase-3/7 Assay (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cells were transfected with 700 ng of plasmid construct (PIB/V5_Gr9) and 3 μl of FuGENE® HD transfection reagent (Promega, USA) in 100 μl of medium per well ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Physiology 2022Quote: A DNA fragment corresponding to partial f5 or f3a cDNAs was amplified from ovarian cDNAs by PCR using the gene-specific primers (see Supplemental Table 3 for detail) (28) and cloned into the pGEM-T Easy vector (Promega, USA). Correct sequence and orientations of inserts were validated by Sanger sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...