Labshake search
Citations for Promega :
1251 - 1300 of 3123 citations for 6 Phenyl hexa 3 5 dien 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cancer Biology 2020Quote: ... Apoptosis was determined using Caspase 3/7-Glo assay kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... freshly add 3 µL 1:1 water diluted digitonin (Promega G9441)) was added ...
-
bioRxiv - Molecular Biology 2019Quote: A 3:1 ratio of FuGENE® HD Transfection Reagent (Promega) (μL ...
-
bioRxiv - Molecular Biology 2019Quote: 25μL of Caspase-Glo®-3/7 or −8 reagent (Promega) was added to 5μg (Caspase-3/7 activity ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 50 µL of Caspase-3/7 Glo Reagent (ProMega, Madison, WI) was added to each well to yield a 100 µL total volume ...
-
bioRxiv - Immunology 2021Quote: ... then each well was diluted 1:3 with TE buffer (Promega). A 2.7 μL aliquot from each sample was mixed with 2.5 μL of SsoFast EvaGreen Supermix with Low Rox (Bio-Rad ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...
-
bioRxiv - Microbiology 2023Quote: ... and a Victor 3 or GloMax Navigator luminometer (Perkin Elmer/Promega). The 50% and 80% inhibitory concentrations (IC50 and IC80 ...
-
bioRxiv - Immunology 2023Quote: ... (3) We used the ProNex Size-Selection DNA Purification System (Promega) to purify PCR products ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used Caspase-Glo 3/7 and 8 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and (1 ...
-
bioRxiv - Biochemistry 2024Quote: ... using random primers and oligo-dT primers (3:1 mol) (Promega). The obtained cDNA was stored at −20 °C until further use.
-
bioRxiv - Cancer Biology 2023Quote: ... 100 µl/well of room temperature Caspase Glo 3/7 (Promega) reagent was added to the treated and control cells ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Biochemistry 2021Quote: ... The residual magnetic beads were then incubated for two hours at 4°C and for one hour at 16°C in 83 microlitres of buffer A200 with 20 Units RNasin (Promega), 12mM DTT and 16 micrograms of TEV-Protease ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting libraries were checked for their quality using the High-sensitivity DNA chip using the Agilent 2100 Bioanalyzer (Waldbroon, Germany) and quantified using the QuantiFluor One dsDNA kit (Promega). Paired-end (2x300bp ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR to detect ZIKV was performed in a 20 μL reaction final volume containing GoTaq one-step RT-qPCR master mix (Promega), 25 ng of sample RNA ...
-
bioRxiv - Microbiology 2020Quote: ... All cells in each well were lysed and luciferase was measured using ONE-Glo™ Luciferase Assay reagent (Promega, US). RLUs are per well of a 96-well plate.
-
bioRxiv - Microbiology 2019Quote: ... The viability of N2a cells was evaluated by Cell Titer 96 AQueous One Solution cell proliferation assay kits (Promega, G3582) according to the manufacturer’s instruction.
-
bioRxiv - Microbiology 2022Quote: ... Indexed libraries were then cleaned using AMPure XP beads and quantified on the Quantus Fluorometer using the QuantiFluor ONE dsDNA System (Promega). Amplicons were purity-checked and sized on a TapeStation using D1000 ScreenTape System (Agilent) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µl of the reaction was treated with 1 µl of RNase mixture (10% RNase A, Sigma + 20% RNase One, Promega), incubated at 37°C for 10 min and then mixed with 6 µl of 2 × SDS-PAGE buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Infected cell death was quantified by the release of the cytosolic enzyme LDH into the culture supernatant at 24h post-infection using the CytoTox-ONE Homogeneous Membrane Integrity Assay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... The cells were subsequently assayed for red Firefly activity using the ONE-GloTM Luciferase Assay System kit (Promega, Madison, WI) on a Spectramax M5 (Molecular Devices ...
-
bioRxiv - Biochemistry 2019Quote: The luciferase activity was measured in WT and ERE mutant URAT1/SLC22A12 promoter stably expressing HepG2 cells using One-Glo EX Luciferase Assay System (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: The metabolic activity of MSCs and ECs was evaluated by CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega) individually ...
-
bioRxiv - Plant Biology 2021Quote: ... One microgram of RNA was reverse transcribed using oligo(dT)18 and M-MLV reverse transcriptase II (Promega, https://worldwide.promega.com/). Quantitative real time PCR (qPCR ...
-
bioRxiv - Plant Biology 2021Quote: ... the activities of the Firefly and NanoLuc luciferases were measured in a TriStar2 LB942 luminometer (Berthold) using the ONE-Glo Luciferase Assay System (Promega) and the Nano-Glo Live Cell Assay System (Promega).
-
bioRxiv - Microbiology 2020Quote: ... MTS assays were performed to measure the cell viability using CellTiter 96 AQueous One reagent (G3580, Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The CellTiter-Glo® Assay System and the ONE-Glo™ Luciferase Assay System were obtained from Promega (Madison WI).
-
bioRxiv - Cancer Biology 2020Quote: Short term cell viability was assessed using the Cell Titer 96 AQeous One Solution MTS cell proliferation assay (Promega, UK), as previously described {Beeby ...
-
bioRxiv - Cancer Biology 2022Quote: Relative cell viability was measured by MTS assays using the CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... Luciferase activity was measured 16 h post-infection using the Bright-Glo Luciferase Assay System or ONE-Glo Luciferase Assay System (Promega) and Centro xS960 luminometer (Berthold).
-
bioRxiv - Microbiology 2021Quote: ... The virus-serum mix was subsequently used to infect A549-hACE2-TMPRSS2 cells7 for 18 hours at 37 °C before adding ONE-Glo reagent (Promega) for measurement of the luciferase signal by relative luminescence units (RLUs) ...
-
bioRxiv - Molecular Biology 2019Quote: Cell viability was determined 72 h after PDS or cisplatin treatment using a CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Relative numbers of viable cells in each well were determined using CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega). Experiments were performed in six biological replicates ...
-
bioRxiv - Microbiology 2021Quote: ... The virus-serum mix was subsequently used to infect A549-hACE2-TMPRSS2 cells [41] for 18 hours at 37°C before adding ONE-Glo reagent (Promega) for measurement of the luciferase signal by relative luminescence units (RLUs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the cells for the luciferase assay were exposed to 100 μL of a 1:1 dilution of DMEM and luciferase substrate (ONE-Glo Luciferase Assay System, Promega), and luminescence from each well measured in a GloMax-96 Microplate Luminometer (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... Parasites viability was assessed by direct light microscope observations and MTS colorimetric assays (CellTiter Aqueous One Solution Cell Proliferation Assay -Promega); they maintained shape and motility at 5 ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was evaluated using the MTS-based CellTiter 96® AQueous One Solution Cell Proliferation Assay kit (Promega, G3582), which determines viable cell number measuring the conversion at 490 nm of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS ...
-
bioRxiv - Microbiology 2021Quote: ... culture supernatant was removed from each well and replaced with 0.3 ml of ONE-Glo luciferase reagent (Promega, Madison, WI). The plates were shaken at 400 rpm for 10 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: Toxicity was measured by quantifying the cell viability using the CytoTox-ONE™ Homogeneous Membrane Integrity Assay kit (Promega, G7891) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... using one of the following antibodies against (all dilutions in PBS): HaloTag® polyclonal anti-rabbit (G928A, Promega, 1:100); ACTN2 monoclonal anti-mouse (EA-53 Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... cellular cytotoxicity was evaluated using the CellTiter 96® AQueous One Solution Cell Proliferation Assay kit using manufacturer’s instructions from Promega. Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... the purified products were quantified with the QuantiFluor® ONE dsDNA System by a QuantusTM Fluorometer E6150 (Promega, Madison, USA).
-
bioRxiv - Immunology 2021Quote: ... cells were transfected with one of the Gag-mCherry variants (8 µg) using FuGene HD according to the manufacturer’s instructions (Promega, USA) in a 3:1 ratio with DNA ...
-
bioRxiv - Immunology 2022Quote: ... Cell viability was assessed using a Cell Titer 96 AQueous One Solution Cell Proliferation Assay (Promega Corp, Madison, Wisconsin, USA). Absorbance measurements at 490 nm were normalized to the maximum read per cell line ...