Labshake search
Citations for Promega :
1251 - 1300 of 2707 citations for 6 METHYL 3 1H TETRAZOL 5 YL 4H CHROMEN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting libraries were checked for their quality using the High-sensitivity DNA chip using the Agilent 2100 Bioanalyzer (Waldbroon, Germany) and quantified using the QuantiFluor One dsDNA kit (Promega). Paired-end (2x300bp ...
-
bioRxiv - Immunology 2021Quote: ... RT-qPCR to detect ZIKV was performed in a 20 μL reaction final volume containing GoTaq one-step RT-qPCR master mix (Promega), 25 ng of sample RNA ...
-
bioRxiv - Microbiology 2020Quote: ... All cells in each well were lysed and luciferase was measured using ONE-Glo™ Luciferase Assay reagent (Promega, US). RLUs are per well of a 96-well plate.
-
bioRxiv - Microbiology 2019Quote: ... The viability of N2a cells was evaluated by Cell Titer 96 AQueous One Solution cell proliferation assay kits (Promega, G3582) according to the manufacturer’s instruction.
-
bioRxiv - Microbiology 2022Quote: ... Indexed libraries were then cleaned using AMPure XP beads and quantified on the Quantus Fluorometer using the QuantiFluor ONE dsDNA System (Promega). Amplicons were purity-checked and sized on a TapeStation using D1000 ScreenTape System (Agilent) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 µl of the reaction was treated with 1 µl of RNase mixture (10% RNase A, Sigma + 20% RNase One, Promega), incubated at 37°C for 10 min and then mixed with 6 µl of 2 × SDS-PAGE buffer ...
-
bioRxiv - Molecular Biology 2019Quote: ... Infected cell death was quantified by the release of the cytosolic enzyme LDH into the culture supernatant at 24h post-infection using the CytoTox-ONE Homogeneous Membrane Integrity Assay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2019Quote: ... The cells were subsequently assayed for red Firefly activity using the ONE-GloTM Luciferase Assay System kit (Promega, Madison, WI) on a Spectramax M5 (Molecular Devices ...
-
bioRxiv - Biochemistry 2019Quote: The luciferase activity was measured in WT and ERE mutant URAT1/SLC22A12 promoter stably expressing HepG2 cells using One-Glo EX Luciferase Assay System (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... NF54-HGL parasites were treated with 3× IC50 for two weeks in two independent experiments and cultures were monitored by luminescence readout on the BioTek Synergy 2 Plate reader using ONE-Glo reagent (Promega). Whole-genome sequencing was performed to test for single nucleotide polymorphisms (SNPs ...
-
bioRxiv - Bioengineering 2020Quote: The metabolic activity of MSCs and ECs was evaluated by CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega) individually ...
-
bioRxiv - Plant Biology 2021Quote: ... One microgram of RNA was reverse transcribed using oligo(dT)18 and M-MLV reverse transcriptase II (Promega, https://worldwide.promega.com/). Quantitative real time PCR (qPCR ...
-
bioRxiv - Plant Biology 2021Quote: ... the activities of the Firefly and NanoLuc luciferases were measured in a TriStar2 LB942 luminometer (Berthold) using the ONE-Glo Luciferase Assay System (Promega) and the Nano-Glo Live Cell Assay System (Promega).
-
bioRxiv - Microbiology 2020Quote: ... MTS assays were performed to measure the cell viability using CellTiter 96 AQueous One reagent (G3580, Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... The CellTiter-Glo® Assay System and the ONE-Glo™ Luciferase Assay System were obtained from Promega (Madison WI).
-
bioRxiv - Cancer Biology 2020Quote: Short term cell viability was assessed using the Cell Titer 96 AQeous One Solution MTS cell proliferation assay (Promega, UK), as previously described {Beeby ...
-
bioRxiv - Cancer Biology 2022Quote: Relative cell viability was measured by MTS assays using the CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... Luciferase activity was measured 16 h post-infection using the Bright-Glo Luciferase Assay System or ONE-Glo Luciferase Assay System (Promega) and Centro xS960 luminometer (Berthold).
-
bioRxiv - Microbiology 2021Quote: ... The virus-serum mix was subsequently used to infect A549-hACE2-TMPRSS2 cells7 for 18 hours at 37 °C before adding ONE-Glo reagent (Promega) for measurement of the luciferase signal by relative luminescence units (RLUs) ...
-
bioRxiv - Molecular Biology 2019Quote: Cell viability was determined 72 h after PDS or cisplatin treatment using a CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Relative numbers of viable cells in each well were determined using CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega). Experiments were performed in six biological replicates ...
-
bioRxiv - Microbiology 2021Quote: ... The virus-serum mix was subsequently used to infect A549-hACE2-TMPRSS2 cells [41] for 18 hours at 37°C before adding ONE-Glo reagent (Promega) for measurement of the luciferase signal by relative luminescence units (RLUs) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the cells for the luciferase assay were exposed to 100 μL of a 1:1 dilution of DMEM and luciferase substrate (ONE-Glo Luciferase Assay System, Promega), and luminescence from each well measured in a GloMax-96 Microplate Luminometer (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... Parasites viability was assessed by direct light microscope observations and MTS colorimetric assays (CellTiter Aqueous One Solution Cell Proliferation Assay -Promega); they maintained shape and motility at 5 ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was evaluated using the MTS-based CellTiter 96® AQueous One Solution Cell Proliferation Assay kit (Promega, G3582), which determines viable cell number measuring the conversion at 490 nm of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS ...
-
bioRxiv - Microbiology 2021Quote: ... culture supernatant was removed from each well and replaced with 0.3 ml of ONE-Glo luciferase reagent (Promega, Madison, WI). The plates were shaken at 400 rpm for 10 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: Toxicity was measured by quantifying the cell viability using the CytoTox-ONE™ Homogeneous Membrane Integrity Assay kit (Promega, G7891) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... using one of the following antibodies against (all dilutions in PBS): HaloTag® polyclonal anti-rabbit (G928A, Promega, 1:100); ACTN2 monoclonal anti-mouse (EA-53 Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... cellular cytotoxicity was evaluated using the CellTiter 96® AQueous One Solution Cell Proliferation Assay kit using manufacturer’s instructions from Promega. Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... the purified products were quantified with the QuantiFluor® ONE dsDNA System by a QuantusTM Fluorometer E6150 (Promega, Madison, USA).
-
bioRxiv - Immunology 2021Quote: ... cells were transfected with one of the Gag-mCherry variants (8 µg) using FuGene HD according to the manufacturer’s instructions (Promega, USA) in a 3:1 ratio with DNA ...
-
bioRxiv - Immunology 2022Quote: ... Cell viability was assessed using a Cell Titer 96 AQueous One Solution Cell Proliferation Assay (Promega Corp, Madison, Wisconsin, USA). Absorbance measurements at 490 nm were normalized to the maximum read per cell line ...
-
bioRxiv - Microbiology 2022Quote: Cell viability of different 2D cultures at different time points of infection or exposure to virus proteins or HAE supernatant was determined using the CellTiter 96 AQueous One Solution cell proliferation assay (G3582; Promega), while HTO viability was determined by the CellTiter-Glo 3D cell viability assay (Promega G9681 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The indicated DNA oligonucleotide and oligonucleotide ‘HDVrt’ were mutually extended upon one another using three thermocycles with GoTaq Hot-start DNA polymerase (Promega). This generated a double-stranded DNA comprising the DNA sequence of the desired RNA oligonucleotide ...
-
bioRxiv - Microbiology 2022Quote: Cell viability was measured using a commercially available kit [CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Madison, USA)] ...
-
bioRxiv - Zoology 2022Quote: ... The sperm suspension was then divided into two samples: one for determining ATP using a CellTiter-Glo Luminescent Cell Viability Assay kit (Promega) and the other for assessing DNA content (to calibrate the ATP content by the number of sperm cells ...
-
bioRxiv - Microbiology 2022Quote: ... allowing to adhere for 24 h before addition of a serial dilution of inhibitor and measurement of cell viability 72 h later using the CellTiter AQueous One solution (Promega), following manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Cell viability was assessed using a Cell Titer 96 AQueous One Solution Cell Proliferation Assay (Promega Corp, Madison, Wisconsin, USA). Absorbance measurements at 490 nm were normalized to the maximum read per cell line ...
-
bioRxiv - Molecular Biology 2022Quote: ... Next two overlapping fragments containing one of the homologies and a part of the antibiotic marker were generated by PCR using Taq polymerase (Promega), which overlap for a length of 594 bp ...
-
bioRxiv - Microbiology 2022Quote: ... allowing to adhere for 24 h before addition of a serial dilution of protease inhibitors and measurement of cell viability 72 h later using the CellTiter AQueous One solution (Promega), following manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... were infected with VSV-G-pseudotyped NL4-3Δenv-luc at a MOI of 0.0001 and Luciferase expression was quantified after two days using the One-Glo™ luciferase assay (Promega) as described previously [8].
-
bioRxiv - Developmental Biology 2023Quote: ... After 7 days of culture the MTS cell viability reagent (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega) was added and plates incubated for 4 hours at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: LDH release from macrophages treated with Aβ profect complexes was measured using the CytoTox-ONE Homogeneous Membrane Integrity Assay (cat no: G7891, Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Equal amounts of the lysate were transferred into two Microtiter plates (one for Renilla and the second for Bright Glo (Promega)) ...
-
bioRxiv - Microbiology 2023Quote: ... Cell proliferation was assessed every 24 h by the MTS assay (CellTiter 96® AQueous One Solution Cell Proliferation, Promega). DMSO-treated cells were used as negative controls and the effects on cell proliferation were expressed as the percentage inhibition compared to the cells of the control group ...
-
bioRxiv - Systems Biology 2023Quote: Cell viability was measured using a commercial kit (Cell Titre 96 AQueous One Solution cell proliferation assay; Promega, Madison, USA) that uses a tetrazolium salt-based colorimetric assay [20] ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Four microliters of CFPS sample were added to 30 μL of ONE-Glo Luciferase Assay System (Promega, Madison WI, USA) in a white 96-well plate (Costar 3693 ...
-
bioRxiv - Plant Biology 2024Quote: ... total RNA was extracted from one week-old Arabidopsis seedlings and reverse transcribed into cDNA using M-MLV reverse transcriptase (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Cell proliferation colorimetric-based assays were performed using 4,000 transduced or transfected cells and the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, G3582) according to the manufacturer’s instructions for 96h ...