Labshake search
Citations for Promega :
1251 - 1300 of 1417 citations for 6 Chloro n propylpyridine 3 carboxamide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Pro-apoptotic caspase 3/7 activation was measured in worms harvested from mice following drug treatment using the Caspase-Glo 3/7 Assay Kit (Promega). Worms were harvested from either the mesenteries or liver of mice ...
-
bioRxiv - Molecular Biology 2019Quote: Validation of hsa-miR-548ba and hsa-miR-7973 direct binding to target gene 3’UTR was performed by using Dual-Glo Luciferase assay system (Promega) according to the user manual ...
-
bioRxiv - Cell Biology 2020Quote: Measurements of caspase activities in cells were performed using the commercially available Caspase-Glo 3/7 Assay (Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purification of tRNAPhe(GAA) was performed using a 5’ biotinylated complementary oligonucleotide (5’-biotin-TGGTGCCGAAACCCGGGATTGAACCGGGG-3’) coupled to Streptavidin Magnesphere Paramagnetic particles (Promega). Annealing of specific tRNA was performed in 1 x TMA buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Biophysics 2019Quote: ... cells were treated with the LRRK2 inhibitor MLi-2 (100 nM) for 2 hours and then labelled with the TMR ligand (3 μM)(Promega). After 15 minutes ...
-
bioRxiv - Pathology 2020Quote: Reporter vectors were generated by inserting the Fam210a 3’UTR fragments containing wild-type or mutated seed sequence into the miRNA reporter vector pmirGlo (Promega). All the primers used to generate the reporter vector were listed in supplemental information ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Cancer Biology 2021Quote: The full length 3’ UTR of c-Myc was cloned into the pmirGLO Dual-Luciferase miRNA target expression vector (Promega). Luciferase activity was assayed in transfected cells using the Dual-Luciferase Reporter Assay (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PAT-PCR was performed using a 3’ UTR-specific forward primer and a y300 PAT universal C10 primer with GoTaq Green Master Mix (Promega). The primer sequences are provided in Table S1 ...
-
bioRxiv - Microbiology 2021Quote: PS cells were seeded at 1.5 × 105 cells per well in 96-well plates (n=3) and transfected with in vitro transcribed TBEV replicon RNA (100 ng/well) and 10 ng of pTK-Ren (Promega) using Lipofectamine-2000 (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Neuroscience 2021Quote: ... Trpc4 and Trpc5 mRNAs was performed on 3 µl of cDNA from single cells in a 30 µl reaction volume containing 1X GoTaq Flexi buffer (Promega), 2 mM MgCl2 ...
-
bioRxiv - Microbiology 2021Quote: ... An MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium]-based viability assay (CellTiter 96 aqueous nonradioactive cell proliferation assay, Promega) was performed as recommended by the manufacturer ...
-
bioRxiv - Immunology 2019Quote: HEK cells were seeded at 3.0 × 106 cells in 10 cm dishes and transfected with 3 μg of the indicated DNA construct using FuGENE HD (Promega). 24 h post-transfection ...
-
bioRxiv - Genetics 2021Quote: ... cell viability followed by caspase 3/7 activity were measured using CellTiter-Fluor™ Cell Viability Assay kit (Promega, G6080) and Caspase-Glo® 3/7 Assay System (Promega ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNAs were amplified (see Supplemental Table 3 for primer sequences) and ligated into pGEM-T vector (Promega, Madison, WI). To generate RNA substrates for EMSA ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’ GA CTC GAG GTT GCA CCT AGT GGA T 3’ The PCR product was first cloned into pGEM-T easy vector (Promega), verified by sequencing and subsequently cloned into pGEX5.1 vector using the EcoRI and XhoI sites ...
-
bioRxiv - Microbiology 2020Quote: ... were then added to the 3’ ends of all fragments by incubation of 3 µg of size-selected DNA fragments with the recombinant terminal deoxynucleotidyl transferase (rTdT, 30 U/µL, Promega) at 37°C for 1H ...
-
bioRxiv - Microbiology 2020Quote: ... glacialis A3 by filtering cells onto a 3-μm polycarbonate filter and using the Wizard SV Genomic DNA Purification kit (Promega) following the manufacturer’s instructions and quantified on a Qubit 3.0 fluorometer using the DNA high sensitivity assay kit (Thermo-Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately overnight using trypsin chymotrypsin or alpha lytic protease (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and proteins were sequentially digested with LysC (1:50, w/w; FUJIFILM Wako) for 3 h at 37 °C and trypsin (50:1, w/w; Promega) overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Luciferase assays require washing the harvested cells 3 times in PBS prior to lysis in passive lysis buffer (Promega, E1941). NLuc activity was assayed using the Nano Luciferase Assay Kit (Promega ...
-
bioRxiv - Immunology 2021Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and two of the aliquots were digested separately overnight using chymotrypsin (Mass Spectrometry Grade, Promega) or alpha lytic protease (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were reduced by dithiothreitol and alkylated by iodoacetamide in the dark at room temperature, followed by in-solution digestion sequentially using lysyl endopeptidase (Lys-C, Wako) for 3 h and trypsin (Promega) overnight at room temperature as previously described (Paul et al. ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Immunology 2022Quote: ... Equal volumes of RNA from fractions corresponding to polysomes (3 fractions after the 80S monosome peak) were pooled and digested with RQ1 DNase (Promega) and cleaned-up using RNA Clean&Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viabilities and Caspase 3/7 activities were measured via Cell Titer-Glo (CTG) Luminescent Cell Viability Assay (Promega, USA) or Caspase-Glo® 3/7 (Promega ...
-
bioRxiv - Immunology 2022Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and two of the aliquots were digested separately overnight using chymotrypsin (Mass Spectrometry Grade, Promega) or alpha lytic protease (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Microbiology 2022Quote: ... at 72° C for 10 min to add 3’-A overhangs for T/A cloning with pGEM-T Easy plasmid (Promega). A 610 bp DNA fragment upstream of flgV was amplified using PCR primers 85 and 86 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and two of the aliquots were digested separately overnight using trypsin (Mass Spectrometry grade, Promega), chymotrypsin (Mass Spectrometry Grade ...
-
bioRxiv - Neuroscience 2022Quote: ... using Lipofectamine 2000 and assays were performed 48 hours later using the Apo-ONE Homogeneous Caspase-3/7 Assay (Promega). Briefly ...
-
bioRxiv - Genomics 2022Quote: ... DNA used for microarray was isolated from frozen cell pellets (3×106-7×106 cells) using the Maxwell RSC Cultured Cells DNA Kit on a Maxwell RSC 48 instrument (Promega). DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... the cDNA fragments corresponding to the coding region or 3′-UTR of mouse Inka2 cDNA were subcloned into a pGEM-3Z plasmid vector (Promega) for in vitro transcription ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were passaged every 3–4 days and regularly checked for mycoplasma infections using a GoTaq G2 Hot Start Taq Polymerase kit from Promega.
-
bioRxiv - Molecular Biology 2024Quote: ... PAT-PCR was performed using a 3′ UTR-specific forward primer and a PAT universal primer with GoTaq Green Master Mix (Promega). The PCR products were separated by 6% PAGE in 0.5× TBE ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PC-3 cell line was authenticated by Macrogen (Korea) using short tandem repeat (STR) profiling (Powerplex 21 System, Promega). All cell lines tested negative for mycoplasma contamination using the Microsart AMP Mycoplasma Kit (Sartorius).
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... All transfections were done in triplicate and luciferase activity measured after 3 days using the Dual Luciferase Reporter Assay System (Promega).
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... total RNA was purified from 3-4 tissues of female flies using a ReliaPrep RNA Tissue Miniprep kit (Promega, z6112). Quantitative RT-PCR was performed using a OneTaq RT‒PCR kit (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...