Labshake search
Citations for Promega :
1251 - 1300 of 1782 citations for 5 Bromo 2 Tert Butyldimethylsilyl 4 Methylthiazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted (2000 g x 5 min) and subjected to genomic DNA (gDNA) extraction using the Wizard Genomic DNA Purification kit (Promega), according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μL of Nano-Glo HiBiT Lytic Detection Reagent was added directly to the cells and incubated for 5 min on an orbital shaker (300 rpm) before recording luminescence on a GloMax Discover (Promega) with 0.2 s integration time.
-
bioRxiv - Immunology 2023Quote: ... samples were diluted 1:1 with water and digested for 1.5 hours at 37 °C with 1 µg of LysC and overnight at 37 °C with 1 µg trypsin (Promega). The peptide mixture was acidified with trifluoroacetic acid (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Microbiology 2022Quote: ... and alkylated with 5 mM of iodoacetamide 30 min in the dark at RT°C prior to digestion with 5 μg of trypsin Gold (Promega) for 15 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 56 °C for 30 seconds and 72 °C for 30 seconds (30 cycles) and 72 °C for 5 minutes using GoTaq DNA polymerase (Promega) and a forward primer (hChimera exon 1-F ...
-
bioRxiv - Neuroscience 2023Quote: ... UDP (at concentrations ranging from 1 nM to 1 mM) was then applied with a final concentration of 5 μM furimazine (NanoLuc Luciferase Assay, Promega). Luminescence was subsequently measured using a Victor X5 multi-label plate reader (PerkinElmer).
-
bioRxiv - Microbiology 2023Quote: ... 5% CO2 before measurement of Renilla and Firefly luciferase activities using Dual-Glo® Luciferase Assay System (Promega, Cat #E2920) and Tecan SPARK plate reader ...
-
bioRxiv - Microbiology 2023Quote: ... were made by replacing the ORF3 region encoding 5–105 amino acids with an in-frame insertion downstream of 4th VP2 codon sequence of UnaG and NanoLuc (Promega) coding regions with their own stop codons ...
-
bioRxiv - Neuroscience 2023Quote: Surface expression was measured using a HiBit-tagged 5-HT2A receptor and the Nano-Glo HiBit Extracellular Detection System (Promega). N-terminal HiBit-tagged human 5-HT2A receptor was cloned into pcDNA3.1 using Gibson Assembly ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was co-transfected at a 1:5 ratio with either the HaloTag-ubiquitin plasmid (expressing Ub-Halo) or the HaloTag control (Promega). Transfected cells were incubated for 20 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: The RNase III.RNA complexes were washed and the 5′ ends of bound RNAs were dephosphorylated with the addition of thermosensitive alkaline phosphatase (Promega). RNA was radiolabelled by phosphorylation with T4 PNK (Sigma-aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was isolated from overnight cultures (5 mL) using the Wizard Genomic DNA Purification Kit (Promega GmbH, Walldorf) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were diluted 5-fold with 25 mM Tris pH 8.0 and 1 mM CaCl2 prior to digesting them with trypsin (Promega, V511X) at a 1:30 enzyme-to-protein ratio at 37 °C in a dry bath for 16 h.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 0.2 mL of 100% acetonitrile and rehydrated with 5 μL of the digestion solution containing 15 μg/mL sequencing-grade trypsin (Promega) in 20 mM aqueous solution of NH4HCO3 ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with or without 50 μM adenosine 5′-triphosphate (ATP) at 30 °C for 30 minutes followed by kinase assays using ADP-Glo Kinase Assay kit (Promega). Data were analyzed using GraphPad Prism 9 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested for 18 h with Trypsin+LysC (Promega) at a ratio of 25:1 protein:protease ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were maintained at 37 °C and 5% CO2.Cell lines were authenticated using Short Tandem Repeat fingerprinting carried out using the GenePrint 10 system (Promega). For 3D spheroids ...
-
bioRxiv - Molecular Biology 2023Quote: ... The final 50 µL translation reaction included the 5 µL RNA mixture described above and components from the Rabbit Reticulocyte Lysate system (Promega): 35 µL of rabbit reticulocyte lysate ...
-
bioRxiv - Biochemistry 2023Quote: ... The first-strand cDNA was synthesized from 5 µg of the total RNA with an oligo (dT) primer using the AMV reverse transcriptase (Promega). A polymerase chain reaction (PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... Each well was transfected with 500 ng pGL4.22 vector with or without H1-0 promoter expression as well as 5 ng Renilla luciferase control plasmid pGL4.73 (Promega, #E6911), and 250 ng of the respective pcDNA3.1 vectors (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... An amount corresponding to 5 % of the pull-down volume was saved for Western blot analyses and 1 µg of trypsin gold (Promega) was then added to the beads for 16 h at room temperature in a thermomixer at 600 RPM ...
-
bioRxiv - Cell Biology 2024Quote: 2-3 days before the recording the cultures were transferred into a recording medium containing 5% FBS and 0.1 mM luciferin (Promega E1601) (Feeney et al. ...
-
bioRxiv - Biophysics 2024Quote: ... Proteins were digested to peptides by adding 25 µL of 50 mM ammonium bicarbonate containing 5 µg of trypsin (Promega) and incubating at 37 °C for 18 hours ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Plates were then incubated for 72 h at 37°C and 5% CO2 and cell viability determined by CellTiter-Glo Luminescent Cell Viability Assay (Promega). In short ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Biochemistry 2024Quote: ... then resuspended in 1 gel volume of 25 mM ABC containing 5 ng/µL of digestion grade trypsin (Promega, V5111) and incubated at 37°C for 16 hours for a full digestion or for 15 minutes for a partial digestion ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the chromatin-associated fraction was sonicated on a Bioruptor (5 times 20 sec on/off intervals) prior to DNase treatment using RQ1 DNase (Promega) and RNA extraction using Trizol ...
-
bioRxiv - Microbiology 2024Quote: ... Purified DENV2 EDIII was biotinylated by incubating 100 µg of DENV2 EDIII with 5 nmol of the HaloTag PEG biotin ligand (Promega) at room temperature (RT ...
-
bioRxiv - Microbiology 2024Quote: ... The 25 μl reaction contained 5 μl of PCR Green Buffer with magnesium chloride (Promega, Cat N° M7845, Madison, USA), 1 μl of 5 mM dNTP ...
-
bioRxiv - Microbiology 2024Quote: ... After three rounds of washing in PBST the following Horseradish peroxidase-conjugated secondary antibodies were diluted in 5% milk-PBST and used with at a 1:10000 dilution anti-rabbit (W4018, Promega), 1:5000 anti-mouse (W402B ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells in each well were resuspended in 30 μL of TLR7-Fc or other Fc-tagged proteins (final concentration 5 μg/mL) in 0.5% BSA in 1x DPBS containing 200U/mL RNasein (Promega, N2511), and incubated on ice for 45 minutes ...
-
bioRxiv - Microbiology 2024Quote: ... Exponentially growing and stationary phase cells yielding a total OD600 of 800 were resuspended in 5 ml 1x FastBreak cell lysis buffer (Promega) for 30 minutes on ice and then sonicated afterwards ...
-
bioRxiv - Neuroscience 2024Quote: Ensembl predicted regulatory region including the POU domain binding site on Aspm promoter/enhance (sequence from 5’-GAAAAAGTGGGCAGTAACTCGC-3’ to 5’-CAACCTTTCCCTGAGGACGATC-3’) was synthesized by Twist Bioscience and cloned into pGL3-Basic Luciferase Reporter vector (Promega) using the Gibson assembly method ...
-
bioRxiv - Cell Biology 2024Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
bioRxiv - Cell Biology 2024Quote: ... cDNAs were amplified with 6 PCR cycles using short Solexa P3/5 primers to allow beads-based size selection with ProNex Beads Size-selection Chemistry (Promega). In order to avoid over-amplification ...
-
bioRxiv - Biochemistry 2024Quote: ... and wild-type or mutant βarr1 with a C-terminal HA tag with a 1:5 DNA:FuGENE®6 (Promega) ratio according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... samples were centrifuged at 200× g for 5 minutes and then analyzed with the Nano-Glo HiBiT Lytic Detection System (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... a separate set of duplicate cell suspensions were measured at 475 nm excitation and 535 nm emission wavelengths after addition of 5 μM coelenterazine-h (Promega). PBS or 10 μM quinpirole was added to cell suspensions and BRET emissions were immediately measured again ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The Renilla luciferase activity associated with WT or uORF-mutated 5’UTRs was measured according to the manual of the Dual-Luciferase Reporter Assay System (Promega) 32 h after transfection and was normalized to the activity of firefly luciferase.
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA (2 µg) was reverse transcribed into cDNA using a cDNA synthesis kit (Promega, Madison, WI, USA). The RT-PCR was assessed using r-Taq plus Master Mix (Elpis Biotech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Dual luciferase assay was performed 2 days post transfection using the Nano-Glo Dual-Luciferase Reporter Assay (Promega) in a Synergy Neo2 microplate reader (Biotek) ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected with CRISPR–Cas9 and donor plasmids (Table 2) using FuGENE HD Transfection Reagent (Promega, #E2311) in a 6-well plate following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR fragments with lengths is above 500 bp to 2 kb were carried out with GoTaq enzyme (Promega) according to standard protocols ...