Labshake search
Citations for Promega :
1201 - 1250 of 1705 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with or without 50 μM adenosine 5′-triphosphate (ATP) at 30 °C for 30 minutes followed by kinase assays using ADP-Glo Kinase Assay kit (Promega). Data were analyzed using GraphPad Prism 9 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... Tris 50mM pH8.0 and samples were heated 5 min at 90°C before digestion in a mix of 500 ng of LysC (Promega) at 37°C for 2h ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested for 18 h with Trypsin+LysC (Promega) at a ratio of 25:1 protein:protease ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... UDP (at concentrations ranging from 1 nM to 1 mM) was then applied with a final concentration of 5 μM furimazine (NanoLuc Luciferase Assay, Promega). Luminescence was subsequently measured using a Victor X5 multi-label plate reader (PerkinElmer).
-
bioRxiv - Microbiology 2023Quote: ... The viability of Vero cells treated with 5-FU and EIDD-1931 alone were assessed using CellTiter-Glo Viability Assay (Promega).
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
FACS-Sortable Picoreactors for Ultra High-throughput Screening of Catalysts in Biphasic EnvironmentsbioRxiv - Bioengineering 2024Quote: ... emulsions of octanol + 5% (w/v) Span 80 + 40 µM Nile Red in an aqueous phase of nuclease free water (Promega) + 200 ng/µL miniprepped plasmid + 5% (w/v ...
-
bioRxiv - Biochemistry 2023Quote: ... The first-strand cDNA was synthesized from 5 µg of the total RNA with an oligo (dT) primer using the AMV reverse transcriptase (Promega). A polymerase chain reaction (PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... The final 50 µL translation reaction included the 5 µL RNA mixture described above and components from the Rabbit Reticulocyte Lysate system (Promega): 35 µL of rabbit reticulocyte lysate ...
-
bioRxiv - Molecular Biology 2024Quote: About 5 μg empty pcDNA3 vector or ZNF410 full-length and ZNF410-ZF plasmids was transiently transfected with FuGENE 6 (Promega) into 10 cm plates of COS-7 cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... 40 µL of digestion solution (1.25 mM TCEP, 5 mM chloroacetamide, 0.2 µg trypsin/Lys-C mix (Promega, cat#V5073), in 100 mM HEPES pH 8.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were treated 24h after seeding and cell viability was assessed 5 days after treatment using the Cell Titer-Glo luminescent cell viability assay (Promega). Cells treated with vehicle control DMSO (0.1% ...
-
bioRxiv - Microbiology 2023Quote: ... The inoculum was added to HEK293T cells and incubated at 37 ° C with 5% CO2 and the luciferase signal was with analyzed using luciferase assay kit (Promega).
-
bioRxiv - Biophysics 2024Quote: ... was incorporated at the 5’ end of the FL open reading frame during PCR amplification from a pRL-CMV vector (Promega). A Kozak consensus sequence and a 50-nucleotide upstream region was incorporated before the translation start site to ensure enough space for the assembly of translation initiation complex77 ...
-
bioRxiv - Neuroscience 2024Quote: ... The Renilla luciferase activity associated with WT or uORF-mutated 5’UTRs was measured according to the manual of the Dual-Luciferase Reporter Assay System (Promega) 32 h after transfection and was normalized to the activity of firefly luciferase.
-
bioRxiv - Cancer Biology 2021Quote: ... total RNA (2 µg) was reverse transcribed into cDNA using a cDNA synthesis kit (Promega, Madison, WI, USA). The RT-PCR was assessed using r-Taq plus Master Mix (Elpis Biotech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Dual luciferase assay was performed 2 days post transfection using the Nano-Glo Dual-Luciferase Reporter Assay (Promega) in a Synergy Neo2 microplate reader (Biotek) ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected with CRISPR–Cas9 and donor plasmids (Table 2) using FuGENE HD Transfection Reagent (Promega, #E2311) in a 6-well plate following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR fragments with lengths is above 500 bp to 2 kb were carried out with GoTaq enzyme (Promega) according to standard protocols ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 μg of DNAse free RNA was used for cDNA synthesis using ImProm-II Reverse transcription system (Promega), as per the manufacture’s recommendation ...
-
bioRxiv - Genomics 2019Quote: ... Alternatively, ¼ of an agarose plug was soaked in GET solution (3% 2-mercaptoethanol, 0.5x QuantiFluor® dye (Promega), 1X TBE ...
-
bioRxiv - Neuroscience 2019Quote: ... Samples were further diluted to a final urea concentration of 2 M and proteins digested with trypsin (Promega) (1/100 ...
-
bioRxiv - Cell Biology 2021Quote: ... promoter fragments were cloned in front of the Renilla luciferase ORF (hRluc) into the psiCHECK-2 vector (Promega, Cat# C8021 ...
-
bioRxiv - Plant Biology 2021Quote: ... 2 ug of RNA were reverse transcribed using a reverse transcription kit (GoScript™ Reverse Transcription System, Promega). The abundance of specific transcript was measured by probing 1 μL cDNA by quantitative real-time PCR in a total volume of 10 µl containg 5 μL SYBR-green master mix (Roche) ...
-
bioRxiv - Microbiology 2020Quote: ... PCR#2 product was ligated to pGEM-T easy vector or TOPO vector following the manufacturer’s instructions (Promega). After transformation in bacteria and plasmid amplification ...
-
bioRxiv - Microbiology 2022Quote: ... virus was removed and cells were transfected with 2 µg of plasmid DNA pUCSP-A24Rcd using FuGeneHD (Promega) following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 8.0) with 2-5µg plasmids pre-digested by XcmI and 50 µg of herring sperm carrier DNA (Promega), then 700 µL of yeast transformation buffer (40% (w/v ...
-
bioRxiv - Bioengineering 2022Quote: ... Uptake of 2-deoxyglucose by the adipocytes was measured using a Glucose Uptake-Glo™ Assay kit (Promega) and luminescence was measured according to the manufacturer’s instructions using a plate reader ...
-
bioRxiv - Molecular Biology 2020Quote: ... The bacterial surface proteins with attached plasma proteins were released by limited proteolysis with 2 μG trypsin (Promega) /37 °C ...
-
bioRxiv - Genetics 2022Quote: ... 2 µl of the extracted genome solution was used as a template for Genome PCR by GoTaq (Promega). The sequences of gw182 gene specific primer set designed around the CRISPR target site were 5’ -GAG TCC AAT TTG AGA AAC GGA GGT CA-3’ and 5’ - CTG ATC GTT TGC GCT TAA CTT CAT TAA TTC T-3’ ...
-
A critical role for heme synthesis and succinate in the regulation of pluripotent states transitionsbioRxiv - Developmental Biology 2022Quote: RNA was extracted after 2 days of culture with the ReliaPrep™ RNA Tissue Miniprep System (Promega, Z6111) following manufacturer’s protocol for non-fibrous tissue by adding RNA lysis buffer on pelleted cells ...
-
bioRxiv - Genetics 2020Quote: ... cells were changed into GloSensor equilibration medium (10% fetal bovine serum and 2% GloSensor assay reagent (Promega E1290) in CO2-independent medium (Gibco 18045-088) ...
-
bioRxiv - Biochemistry 2019Quote: ... In-column digest was performed by adding 25 µL of a solution containing 2 µg trypsin (Promega, V5111) in 50 mM TEAB pH 8.0 ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was assayed with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) colorimetric assay (Promega) per manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Immunology 2019Quote: ... NGP conditional medium was collected 2 days after transfection of NGP to 293T cells by Fugene HD (Promega). 10 ng/ml of LPS was mixed with conditional medium for 30 minutes and then treated to THP-1 cells.
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was generated from 20-100 ng of RNA using the GoTaq 2-step RT-qPCR System (Promega). qPCR was performed with SYBR Green on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was generated from 20-100 ng of RNA using the GoTaq 2-step RT-qPCR System (Promega). qPCR was performed with SYBR Green on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing 2μl of lysis buffer (1.9ml of 0.2% v/v Triton-X l00 v/v + 0.1ml of RNasin Plus RNase inhibitor (10,000 U/ml, Promega). Smart-seq2 protocol was performed as described in Picelli et al [43] ...
-
bioRxiv - Genetics 2020Quote: ... The 10 µL Zn-finger PCR reaction was prepared containing of 2 µL of 5X reaction buffer (Promega), 0.8 µL of 2.0 mM MgCl2 ...
-
bioRxiv - Microbiology 2021Quote: ... virus inoculum was removed and cells were then transfected with 2 µg of plasmid DNA using FuGeneHD (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: Calpain activity was measured in Caco-2 cell or organoids extracts by Calpain-Glo™ Protease Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... genomic DNA was extracted from 2-wk old seedlings by using the Wizard Genomic DNA purification kit (Promega) and was subjected to PCR analysis by using a primer set consisting of a specific CaM35S promoter sequence and a gene-specific primer (Table S1) ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μg of RNA were reverse transcribed using a reverse transcription kit (GoScript™ Reverse Transcription System, Promega). The abundance of specific transcript was measured by probing 1 μL cDNA by quantitative real-time PCR in a total volume of 10 μl containg 5 μL SYBR-green master mix (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 μg of the spike SARS2 (D614G)-pCAGGS (Medicines & Healthcare Products Regulatory Agency CFAR100985) using FugeneHD (Promega) transfection reagent at a ratio of 1:3 DNA:Fugene in optiMEM (Gibco) ...
-
bioRxiv - Cancer Biology 2023Quote: ... All PCR reactions were run using 2 µL of extracted DNA in GoTaq® PCR Master Mix (Promega) and the following cycling protocol ...