Labshake search
Citations for Promega :
1201 - 1250 of 5372 citations for 6 9 Methano 4 1 benzoxazepin 2 3H one octahydro 3 methyl 3 α 5a bta 6 bta 9 bta 9a bta 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... approximately 0.6 mg IgG-enriched proteins were first digested on the beads with mass spectrometry-grade Trypsin/Lys- C Mix (Promega, Madison, WI, USA) at a 1:50 (enzyme/substrate ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5 µg retroviral vectors were independently introduced into Plat-GP cells using 2.25 µL of FuGENE 6 transfection reagent (Promega, Madison, WI, United States). In addition ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK-293 cells cultured in DME/F-12 with 10% fetal bovine serum were transfected with either of these constructs using FuGENE 6 Transfection Reagent (#E2691) from Promega (Madison, WI, USA). Approximately 72 hours after transfection ...
-
bioRxiv - Immunology 2021Quote: ... Pseudovirions were produced in HEK 293T/17 cells (ATCC cat. no. CRL-11268, Manassas, VA, USA) by transfection using Fugene 6 (catalog number E2692, Promega, Madison, WI, USA) and a combination of spike plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... COS-7 cells were transiently transfected with 2μg plasmid (MuSK-HA, or GFP-Vangl2 alone, or in combination) using Fugene® 6 reagent (Promega, catalog no. E2311), according to the manufacturer’s recommendations ...
-
bioRxiv - Physiology 2023Quote: Glutathione content was measured under normoxic conditions and after exposure to 30 min and 6 h hypoxia using the GSH-Glo Assay Kit (Promega, Madison, WI, USA) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Three μL (6 ng on average) of template DNA was added to 5 μL 5x GoTaq Green Reaction Mix Buffer (Promega, Madison, Wisconsin, USA), 0.625 units of GoTaq DNA Polymerase (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... NF54-HGL parasites were treated with 3× IC50 for two weeks in two independent experiments and cultures were monitored by luminescence readout on the BioTek Synergy 2 Plate reader using ONE-Glo reagent (Promega). Whole-genome sequencing was performed to test for single nucleotide polymorphisms (SNPs ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U μL-1 RNasin (Promega), 1 mM ATP/GTP/CTP ...
-
bioRxiv - Microbiology 2019Quote: ... goat α-mouse IgG antibodies (Promega) and donkey α-goat IgG (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... goat α-mouse IgG antibodies (Promega) and donkey α-goat IgG (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... goat α-mouse IgG antibodies (Promega) and donkey α-goat IgG (Abcam ...
-
bioRxiv - Biochemistry 2019Quote: ... The Cyto-Tox ONE (Promega; LDH release from cells with damaged membranes ...
-
bioRxiv - Microbiology 2020Quote: ... RNAse One (50 U; Promega) and Benzonase (250 U ...
-
bioRxiv - Immunology 2021Quote: ... One-Glo-EX substrate (Promega) was added and incubated in the dark for 5 minutes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 0.25 units RNase One (Promega) at 30 °C for 2 h ...
-
bioRxiv - Microbiology 2024Quote: ... and RNase ONE Ribonuclease (Promega) to deplete host and bacterial nucleic acid ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.25 units RNase One (Promega) at 30 °C for 1-2 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cancer Biology 2024Quote: ... Spheroids were treated as indicated for 3 days and viability was measured using 3D CellTiter-Glo (#G9682, Promega) and a GloMax luminometer (Promega).
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptotic cell count was measured as described above using the Caspase-Glo® 3/7 3D Assay (Promega). Bliss synergy scores were calculated using the SynergyFinder web application (version 3.0)61.
-
bioRxiv - Neuroscience 2024Quote: ... the wild type and mutated Nnat 3’UTR was inserted into a pmirGLO dual-luciferase expression vector (Promega). Detailed description of the design of these constructs and of the rescue constructs are listed in the supplementary material section ...
-
bioRxiv - Neuroscience 2022Quote: RNA was extracted from sections of frozen mouse brain cerebrum representing each treatment group (n = 6 per group) using the Maxwell 16 LEV simplyRNA Tissue Kit (Promega, Ipswich, MA, USA; AS1270). RNA was extracted from cultured cells using the Maxwell 16 Cell LEV Total RNA Purification Kit (Promega ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... in 50 µL of 100 mM ABC for 3h at 1200 rpm at 37°C followed by overnight trypsin digestion using 0.2 µg of trypsin (Promega) per sample in 100 mM ABC without 0.1% SDC ...
-
bioRxiv - Biophysics 2023Quote: ... sapiens αE-catenin56-906 (FL α-catenin) or αE-catenin56-871 (α-catenin ΔC) and HaloTag (Promega) into pET vector 2HR-T through Gibson assembly (57).
-
bioRxiv - Microbiology 2022Quote: ... a one-fifth volume of CellTiter 96 AQueous One Solution Cell Proliferation Assay (G3580, Promega) was added to DMEM/Pen/Strep containing 2% FBS and incubated for 2 h ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Cell Biology 2019Quote: ... nuclei from HepG2 cells were isolated by incubating cell pellets in 500 μl of a hypotonic buffer for 15 min on ice (20 mM Tris-HCL, pH 7.4, 10 mM NaCl, 3 mM MgCL2, with protease and phosphatase inhibitor cocktail from Promega). Triton X-100 detergent was added to a 0.5% v:v final concentration to lyse the cells followed by centrifugation at 1200 × g for 10 min to pellet nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... fumigatus pyrGAf gene and 870 nucleotides of the myoE 3’-UTR region was cloned in pGEM-T easy (Promega). This plasmid was used as template for site-directed mutagenesis (QuickChange kit ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild-type and mutant MMP2 3′-UTRs were synthesized and recombined into pmirGLO Luciferase vectors (Promega, Madison, WI, USA). Then pmirGLO-Wt/pmirGLO-Mt or miR-1299 mimics/miR-NCs were co-transfected into EC9706/KYSE30 cells ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Immunology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately O/N using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Molecular Biology 2019Quote: ... 200 µg lysate was mixed with 0.1 µl RNase A (~3 mg/ml) and increasing concentrations of RNasin (Promega), as indicated ...