Labshake search
Citations for Promega :
1151 - 1200 of 1534 citations for C C Motif Chemokine Ligand 23 CCL23 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... CDC was measured after incubation for 3 hours at 37 °C 5% CO2 with a luminometer using the CytoTox-Glo Cytotoxicity Assay (Promega; Cat. Nr.: G9291) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2022Quote: ... They were later subjected to reverse transcription for 45 min at 37°C with 200 U of reverse transcriptase M-MLV (Promega, Madison, WI, USA) in the appropriate buffer.
-
bioRxiv - Neuroscience 2022Quote: ... and 30 s extension at 72 °C using the specific primers (Forward: CCACGCAACACACAGTCAAG, Reverse: GCAAGTTACTTTGCAGAGGTC) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 μl ...
-
bioRxiv - Cell Biology 2023Quote: ... 35S-methionine-labeled Ctb or its derivatives were produced in coupled in vitro transcription and translation reaction (IVTT, at 30 °C for 1 h) using TNT Quick Coupled Transcription/Translation System (cat#L1170, Promega, Madison, WI, USA). Prey proteins were diluted in binding buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and digested with Lys-C (1/200 weight of protein; Fujifilm Wako) and sequencing grade modified trypsin (1/100 weight of protein; Promega, Madison, WI, USA) at 37 °C overnight in 0.1 % Rapigest ...
-
bioRxiv - Systems Biology 2023Quote: ... at the ratio of 1:50 for 3 h at 37°C and then using trypsin (sequencing grade modified trypsin; Promega, Fitchburg, WI, USA) at the ratio of 1:50 at 37°C overnight (for 15 h to 18 h ...
-
bioRxiv - Cell Biology 2023Quote: Affinity purified proteins retained on beads were resuspended in 100 µL of NH4HCO3 at 25 mM containing 2 µg of Trypsin/Lys-C mix (Mass Spec Grade, Promega, Madison, WI, USA). Digestion was performed under agitation at 37°C during 4h ...
-
bioRxiv - Molecular Biology 2024Quote: ... In vitro transcribed and translated FLAG-tagged ERRα protein was made using the TnT reticulocyte reaction (Promega cat #L1170, 2h on 37°C) or the TnT wheat germ extract (cat #L5030 ...
-
bioRxiv - Bioengineering 2023Quote: ... Reverse transcription was performed at 70 °C for 5 min and 42 °C for 60 min with 1 µg total RNA using ImProm-II reverse transcriptase (Promega, Madison, WI, USA) and 250 ng oligo(dT)12-18 primers (ThermoFisher ...
-
bioRxiv - Developmental Biology 2019Quote: Fragments of putative Fgfr2 promoter and Etv5-motif-mutated Fgfr2 promoter were cloned into pGL3-basic reporter vector (Promega). The cloning primers are included in Table S6 ...
-
bioRxiv - Biophysics 2020Quote: ... samples were blocked in 20% normal goat serum (NGS) for 1 h and incubated with the HaloTag® Biotin Ligand (Promega, 200-fold dilution) in PBS supplemented with 5% NGS overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were diluted 10-fold with 50 mM triethylammonium bicarbonate buffer at pH 8 and incubated overnight at 37°C with sequencing grade trypsin (Promega, San Luis Obispo, CA) at a 1:50 enzyme:substrate ratio (wt/wt) ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by a second dilution step to ~1 M urea with 50 mM NH4HCO3 and addition of trypsin (Promega, 1:50, 37 °C, overnight). After overnight incubation ...
-
bioRxiv - Immunology 2022Quote: ... and digested over-night with Lys-C-Trypsin mix (1:100 enzyme to protein ratio) and trypsin (Promega; 1:50 enzyme to protein ratio). Following the digestion step ...
-
bioRxiv - Cell Biology 2019Quote: ... then alkylation solution was removed and gel pieces were hydrated for 45 min at 4 °C in digestion solution (5 ng/μl trypsin, sequencing grade, Promega, in 25 mM AB). The trypsin digestion proceeded for 2 hours at 37 °C on Thermomixer (750 rpm ...
-
bioRxiv - Cell Biology 2019Quote: ... then alkylation solution was removed and gel pieces were hydrated for 45 min at 4°C in digestion solution (5 ng/μl trypsin, sequencing grade, Promega, in 25 mM AB). The trypsin digestion proceeded for 2 hours at 37°C on Thermomixer (750 rpm ...
-
bioRxiv - Immunology 2020Quote: ... After a migration time of 4 h at 37°C (5 % CO2) lower compartment were analyzed for cell content by Cell-Titer-Glo® assay (Promega, Madison, WI, USA). Percentages of migrated cells were calculated as described before45 and normalized to the CXCL12-only control.
-
Throat colour polymorphism in relation to sex and body size of the Litter skink, Lankascincus fallaxbioRxiv - Zoology 2022Quote: ... The PCR amplification was carried out in 25 μl volumes employing 35 cycles with an annealing temperature of 55 °C following standard PCR protocols with Promega PCR master mix (Promega Corporation, Madison, Wisconsin, USA). The success of the PCR amplification of each sample was confirmed through Gel electrophoresis using 5 μl of each sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted with ABC to a final concentration of 1 M urea and digested using trypsin (Promega, V5113; 3 μg/mL, 37°C, 16 h). After digestion ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pellets were washed twice with ice-cold ethanol followed by overnight incubation at 37°C in 100 mM ABC containing 1 mM CaCl2 and trypsin (Sequencing grade, modified, Promega Co, Madison, WI, USA). Digested proteins were evaporated and each sample was freed from salts and buffers by solid-phase extraction on C18 resin using cartridges prepared in-house ...
-
bioRxiv - Synthetic Biology 2023Quote: Casp3-containing matrix consisted of an N- and C-terminally HaloTag®-ed Casp3 coupled to Magne® HaloTag beads (Promega, Cat.-No. G7281). To ensure binding on both termini ...
-
bioRxiv - Microbiology 2020Quote: ... The urea concentration was adjusted to 2M by the addition of water prior to enzymatic digestion at 37°C with trypsin (Promega Seq. Grade Mod. Trypsin, # V5113) for 16 h ...
-
bioRxiv - Neuroscience 2021Quote: ... A 587-bp region of the human Cyp24a1 gene promoter that contains two VDRE motifs was cloned into the promoter-less luciferase expression vector pGL3-basic (Promega) (47) ...
-
bioRxiv - Cancer Biology 2021Quote: The 3’UTR of EIF3A (or mutants lacking U/TAG motif) were cloned downstream of the Renilla luciferase in the XhoI and NotI sites of psiCHECK2 vector (Promega, Madison ...
-
bioRxiv - Evolutionary Biology 2020Quote: To generate the pGl3-STK38-P luciferase reporter,1.2 kb of DNA upstream the STK38 TTS promoter region with ZNF611 binding motif was amplified by polymerase chain reaction (PCR) and cloned into the Firefly luciferase reporter plasmid pGL3-Basic (Promega) using KPN1 and XHO1 restriction sites.0.7 kb of DNA upstream the STK38 TTS promoter region without ZNF611 binding motif was cloned into pGL3-Basic using same restriction sites to generate the pGl3-STK38-ΔP luciferase reporter ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2024Quote: Each ZNF410 peak and all the variants of ZNF410 motif mutant sequences were sub-cloned into pGL4.24 plasmid (Promega, #E8421). About 1.2 μg WT or constructed pGL4.24 plasmid and 0.2 μg pGL4.74 control plasmid (Promega ...
-
bioRxiv - Biophysics 2022Quote: ... spheroplast/sucrose buffer suspension was added to 500 μL warm (42 °C) agarose solution (low melting point agarose, V2831 Promega, 2% w/v in sucrose buffer) using a cut pipette tip ...
-
bioRxiv - Cancer Biology 2022Quote: ... the beads were washed in the ABC buffer (50mM ammonium bicarbonate, pH 8.3) and proteins digested on beads with TPCK-trypsin (Promega, Madison, WI, 16 hours at 37 °C). The supernatant containing the tryptic peptides was collected and lyophilized ...
-
bioRxiv - Cell Biology 2021Quote: ... LgBiT antibody (N710A) and HiBiT antibody were acquired from Promega. Chicken polyclonal MAP2 (ab5392) ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies were detected using HRP-conjugated mouse secondary antibody (Promega). UAP56/DDX39B [1:2000] (custom generated51 ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibody was detected using HRP-conjugated chicken secondary antibody (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies were detected using HRP-conjugated rabbit secondary antibody (Promega). Anti-Beta Tubulin III (Tuj1 ...
-
bioRxiv - Immunology 2023Quote: ... Secondary antibodies (Promega) were incubated for 1 h at RT ...
-
bioRxiv - Microbiology 2020Quote: ... antibody with HRP-conjugated anti-mouse secondary antibody (GE Healthcare or Promega). In addition to the experimental samples ...
-
bioRxiv - Plant Biology 2020Quote: ... an immunoblot with anti-halo antibody (Anti-HaloTag® Monoclonal Antibody-Promega) was performed to confirm protein expression and binding efficiency for each TF ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies used are anti-HaloTag monoclonal antibody (Promega, G921A, 1:1000), and polyclonal rabbit antibodies ...
-
bioRxiv - Immunology 2023Quote: ... Anti-HiBiT antibody (Promega) was used as a positive control for each peptide ...
-
bioRxiv - Biophysics 2023Quote: ... The secondary antibody (Promega: anti-rabbit #W4011 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibodies were detected with an anti-mouse secondary antibody conjugated to HRP (Promega) at 1:5000 dilution in 5% fat-free milk ...
-
bioRxiv - Biochemistry 2022Quote: ... but the secondary antibodies were goat anti-mouse HRP conjugated antibody (Promega Cat #W4021) and goat anti-rabbit HRP conjugated antibody (Promega Cat # W4011) ...
-
bioRxiv - Microbiology 2023Quote: ... Antibodies were visualized by using anti-rabbit immunoglobulin G-alkaline phosphatase secondary antibodies (Promega) and the CDP-star detection system (Roche Diagnostics ...
-
bioRxiv - Genetics 2020Quote: ... Secondary antibodies were from Promega (catalog nos ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP Conjugate Antibody (Promega-W4021). Immuno-blots were developed using enhanced chemiluminescence (Clarity -Biorad ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP Conjugate antibody (Promega -W4011), Anti-Mouse IgG (H+L) ...
-
bioRxiv - Genetics 2019Quote: ... HRP-conjugated secondary antibodies (Promega) were diluted 1:5000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Secondary antibodies used included alkaline phosphatase-conjugated anti-rabbit IgG antibody (1:1,000, #S3738, Promega) and anti- mouse IgG antibody (1:1,000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Bound antibodies were detected using the appropriate horseradish peroxidase-conjugated secondary antibodies (1:10000, Promega). Chemiluminiscent signals were detected with an ECL Prime Western blotting detection kit (GE Healthcare ...
-
bioRxiv - Cell Biology 2024Quote: ... Protein detection was done using primary antibody anti-HaloTag monoclonal antibody (1:1,000 dilution, Promega), primary antibody anti-MamE polyclonal antibody (1:3,000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... for 2 h as primary antibody and peroxidase-conjugated goat anti-rabbit antibody (1:10,000; Promega) for 1 h with 5 times 10 min washes in-between the incubations ...