Labshake search
Citations for Promega :
1101 - 1150 of 3562 citations for 3' Methyl 1 1' biphenyl 4 amine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... cells were treated with 1 μM HaloPROTAC3 (Promega GA3110) or DMSO as control ...
-
bioRxiv - Cell Biology 2024Quote: ... and 1 μl M-MLV-RT enzyme (M1701, Promega). PCR was performed in a 20 μl vol ume containing 10 pmol of each primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... The endpoints of the second screen were caspase 3/7 activity measured using the CaspaseGlo® 3/7 assay reagent (Promega) at the 8-hour and 16-hour time intervals ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... Apoptosis was determined as Caspase-3/7 activity immediately after 6-day culture using Caspase-Glo 3/7 Assay (Promega, USA). Luminescence was recorded with the Infinite M200 PRO microplate reader (Tecan ...
-
bioRxiv - Cancer Biology 2024Quote: ZEB1 3′UTR region with mitomiR-3 binding site was cloned into pmirGLO-Dual Luciferase miRNA target expression vector (Promega, USA) for miRNA luciferase reporter assay (Promega ...
-
bioRxiv - Systems Biology 2020Quote: ... TFE was then diluted to 25% with 50mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... TFE was then diluted to 25% with 50 mM ABC, LysC (Wako Chemicals, 1:100 lysC:protein ratio) and sequencing-grade modified trypsin (Promega, 1:50 trypsin:protein ratio) was added and incubated overnight at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were then diluted to a final guanidine chloride concentration of 1 M with 100 mM ammonium bicarbonate and digested with sequencing grade porcine trypsin (Promega, 1:100 trypsin:protein) for 22 h at 37° C ...
-
bioRxiv - Molecular Biology 2023Quote: ... or stimulated for 10 minutes or 1 hour by BRET through activation of NanoLuc’s bioluminescence with its substrate furimazine (1:100 dilution of Promega nano-Glo Live Assay). After treatment ...
-
bioRxiv - Cell Biology 2023Quote: ... a master mix was prepared by diluting the Extracellular NanoLuc Inhibitor at a 1:1000 ratio and the NanoBRET Nano-Glo Substrate at a 1:333 ratio in PBS (Promega, Madison, WI, USA). Aliquots of the Nluc substrate/inhibitor master mix (100 µl ...
-
bioRxiv - Immunology 2023Quote: ... prepared by combining ONE-Glo™ EX Luciferase Assay Buffer with ONE-Glo™ EX Luciferase Assay Substrate in 1:1 ratio (Promega, USA). After measuring the signal of the Firefly luciferase in the GloMax® 20/20 Luminometer (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1 μg of pPAX packaging vector and 1 μg of VSV-G envelope vector using FuGENE® HD Transfection Reagent (Promega, cat.no. E2311), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... we prepared a master mix containing the membrane-permeable Nluc substrate and a membrane-impermeable Nluc inhibitor using a 1:1000 dilution of Extracellular NanoLuc Inhibitor and a 1:333 dilution of NanoBRET Nano-Glo Substrate into PBS (Promega, Madison, WI, USA). Aliquots of the Nluc substrate/inhibitor master mix (100 µl ...
-
bioRxiv - Molecular Biology 2024Quote: ... and digested with Lys-C (1/200 weight of protein; Fujifilm Wako) and sequencing grade modified trypsin (1/100 weight of protein; Promega, Madison, WI, USA) at 37 °C overnight in 0.1 % Rapigest ...
-
bioRxiv - Bioengineering 2024Quote: ... The samples were then diluted to a concentration of 1 M urea and underwent a second digestion step with porcine trypsin (enzyme/substrate: 1/50; Promega, Madison, WI, USA) at 37°C for 18 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 ng of Renilla (pRL-CMV, Promega), and 0.12 μL of X-tremeGENE HP ...
-
bioRxiv - Genetics 2022Quote: ... 4 units RQ1 RNase-free DNase (Promega), protease and phosphatase inhibitor mix (Halt ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 U RNaseIn plus Ribonuclease Inhibitor (Promega), 1 mM NaF and 100 µM luciferin (Promega)] to a final volume of 15 µl with water ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 µl of RQ DNAse I (Promega), 21 µl of nuclease-free water and 5 µl of CaCl2 (10mM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 4 μL/well of Bright-Glo (Promega) was dispensed ...
-
bioRxiv - Genomics 2020Quote: ... 4 × Protease Inhibitor (Promega, Cat. No. G6521)] ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 or 4 (Promega Madison, WI, USA) (62) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and 4 μl of FuGENE 6 (Promega) in 100 μl of OPTI-DMEM ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4 U/μl reverse transcriptase (Promega). 2 µl of cDNA were used for Real-Time PCR with self-designed primers and SYBR green reaction (Roche) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 µl 5x reaction buffer (Promega, M289A), 2.4 µl MgCl2 (Promega ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4 µl 5x reaction buffer (Promega, M289A), 2.4 µl MgCl2 (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 ng of Renilla control plasmid (Promega) and 0.62 μL of Lipofectamine 2000 Transfection Reagent (InvitrogenTM) ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4 U/mL RQ1 DNase (Promega), samples were incubated at room temperature (25°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 4 µL Mg2+ free PCR buffer (Promega), 4 µL 25 mM MgCl2 ...
-
bioRxiv - Biochemistry 2024Quote: Flexi Rabbit Reticulocyte Lysate (4 μL, Promega) was diluted with 4 μL solution containing amino acid mixture (100 μM) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cell Biology 2021Quote: ... Caspase 3/7 activity was measured 24 hours post-cytokine treatment using the Caspase-Glo® 3/7 Assay System (Promega, #G8090).
-
bioRxiv - Cancer Biology 2022Quote: ... Apo-one Homogeneous Caspase-3/7 Assay kit was performed according to the manufacturer’s protocol to calculate caspase 3/7 activity (Promega Corporation, Madison, WI). Additionally ...
-
bioRxiv - Cancer Biology 2022Quote: ... cell viability and caspase 3/7 activity were evaluated using CellTiter-Glo and Caspases-Glo 3/7 assays (both from Promega, Madison, WI), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Caspase 3/7 activity was quantified in cell culture by using the Caspase-Glo 3/7 assay system (Promega, Madison, WI, USA). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by a second dilution step to ~1 M urea with 50 mM NH4HCO3 and addition of trypsin (Promega, 1:50, 37 °C, overnight). After overnight incubation ...
-
bioRxiv - Immunology 2022Quote: ... and digested over-night with Lys-C-Trypsin mix (1:100 enzyme to protein ratio) and trypsin (Promega; 1:50 enzyme to protein ratio). Following the digestion step ...
-
bioRxiv - Microbiology 2020Quote: ... 10 μL containing 3 units of DNase I (Promega) and 1 μL of CaCl2 was added ...
-
bioRxiv - Biochemistry 2020Quote: ... 100 µL/well of Caspase 3/7 reagent (Promega) was added per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... using the Caspase-Glo® 3/7 assay (Promega).