Labshake search
Citations for Promega :
1001 - 1050 of 1921 citations for L β Homo β 2 hydroxyphenyl glycine; R 3 Amino 3 2 hydroxyphenyl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: The full length 3’ UTR of c-Myc was cloned into the pmirGLO Dual-Luciferase miRNA target expression vector (Promega). Luciferase activity was assayed in transfected cells using the Dual-Luciferase Reporter Assay (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... PAT-PCR was performed using a 3’ UTR-specific forward primer and a y300 PAT universal C10 primer with GoTaq Green Master Mix (Promega). The primer sequences are provided in Table S1 ...
-
bioRxiv - Microbiology 2021Quote: PS cells were seeded at 1.5 × 105 cells per well in 96-well plates (n=3) and transfected with in vitro transcribed TBEV replicon RNA (100 ng/well) and 10 ng of pTK-Ren (Promega) using Lipofectamine-2000 (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Neuroscience 2021Quote: ... Trpc4 and Trpc5 mRNAs was performed on 3 µl of cDNA from single cells in a 30 µl reaction volume containing 1X GoTaq Flexi buffer (Promega), 2 mM MgCl2 ...
-
bioRxiv - Genetics 2021Quote: ... cell viability followed by caspase 3/7 activity were measured using CellTiter-Fluor™ Cell Viability Assay kit (Promega, G6080) and Caspase-Glo® 3/7 Assay System (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... n=4 vaginal) and rUTI (n=3 urine) cohorts belonging to B2 phylogenetic group was extracted (Wizard Genomic DNA Purification Kit, PROMEGA) and sequenced by Illumina NovaSeq 2×150 nt ...
-
bioRxiv - Plant Biology 2021Quote: ... The cDNAs were amplified (see Supplemental Table 3 for primer sequences) and ligated into pGEM-T vector (Promega, Madison, WI). To generate RNA substrates for EMSA ...
-
bioRxiv - Microbiology 2020Quote: ... were then added to the 3’ ends of all fragments by incubation of 3 µg of size-selected DNA fragments with the recombinant terminal deoxynucleotidyl transferase (rTdT, 30 U/µL, Promega) at 37°C for 1H ...
-
bioRxiv - Microbiology 2020Quote: ... glacialis A3 by filtering cells onto a 3-μm polycarbonate filter and using the Wizard SV Genomic DNA Purification kit (Promega) following the manufacturer’s instructions and quantified on a Qubit 3.0 fluorometer using the DNA high sensitivity assay kit (Thermo-Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately overnight using trypsin chymotrypsin or alpha lytic protease (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and proteins were sequentially digested with LysC (1:50, w/w; FUJIFILM Wako) for 3 h at 37 °C and trypsin (50:1, w/w; Promega) overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Luciferase assays require washing the harvested cells 3 times in PBS prior to lysis in passive lysis buffer (Promega, E1941). NLuc activity was assayed using the Nano Luciferase Assay Kit (Promega ...
-
bioRxiv - Immunology 2021Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and two of the aliquots were digested separately overnight using chymotrypsin (Mass Spectrometry Grade, Promega) or alpha lytic protease (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... proteins were reduced by dithiothreitol and alkylated by iodoacetamide in the dark at room temperature, followed by in-solution digestion sequentially using lysyl endopeptidase (Lys-C, Wako) for 3 h and trypsin (Promega) overnight at room temperature as previously described (Paul et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... total RNA was purified from 3-4 tissues of female flies using a ReliaPrep RNA Tissue Miniprep kit (Promega, z6112). Quantitative RT-PCR was performed using a OneTaq RT‒PCR kit (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... All transfections were done in triplicate and luciferase activity measured after 3 days using the Dual Luciferase Reporter Assay System (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... Other parameters of ER Stress induced cell death were measured through immunoblotting or with the Caspase 3/7 Glo Assay Kit (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Biochemistry 2023Quote: ... using 3 µl of the in vitro translation reaction mixture in 150 µl of luciferase assay reagent (Promega, Fitchburg, WI). The graphs in Fig ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Cancer Biology 2023Quote: ... We co-transfected cells with the Tol2 GIV transposon and a Tol2 transposase (Vector Builder) at a 3:1 ratio of micrograms of plasmid DNA using Fugene 6 (Promega) according to the manufacturer’s directions ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Select colonies were then grown in 3 ml of LB with appropriate antibiotics and the plasmids were purified with PureYield Plasmid Miniprep System (Promega), performing restriction enzyme digests to verify that the plasmids had inserts.
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... the cDNA fragments corresponding to the coding region or 3′-UTR of mouse Inka2 cDNA were subcloned into a pGEM-3Z plasmid vector (Promega) for in vitro transcription ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were passaged every 3–4 days and regularly checked for mycoplasma infections using a GoTaq G2 Hot Start Taq Polymerase kit from Promega.
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA was extracted from lymphoma derived cell lines as described above and PCR amplified using sgRNA specific primers (Supplementary Table 3, p53 primers as previously described (13) and GoTaq Green Master Mix (Promega). PCR products were amplified a second time using indexing primers ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... The PC-3 cell line was authenticated by Macrogen (Korea) using short tandem repeat (STR) profiling (Powerplex 21 System, Promega). All cell lines tested negative for mycoplasma contamination using the Microsart AMP Mycoplasma Kit (Sartorius).
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Systems Biology 2024Quote: ... The assay was repeated three times and was conducted using the Caspase Glo® 3/7 assay kit (Promega, USA) based on the manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2024Quote: ... PAT-PCR was performed using a 3′ UTR-specific forward primer and a PAT universal primer with GoTaq Green Master Mix (Promega). The PCR products were separated by 6% PAGE in 0.5× TBE ...
-
bioRxiv - Neuroscience 2023Quote: Wild-type and mutant Shank2 and Mdga1 3′ UTR luciferase constructs were generated by standard cloning procedures into pmiRGLO dual-luciferase expression vector (Promega). First ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase3/7 activity was quantified in cell lysates using the Kit Caspase-Glo® 3/7 Assay Systems (G8091, Promega).
-
bioRxiv - Cell Biology 2023Quote: The Human SART1 mutant resistant to siSART1#3 and its deletions mutants (amplified by PCR) were subcloned into pCI-neo Mammalian Expression Vector (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... was added to 3 of the wells per treatment condition and 50 µL Oxidized Glutathione Lysis Reagent (Promega Cat #TM344) was added to the other 3 wells per treatment condition ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Immunology 2022Quote: ... Equal volumes of RNA from fractions corresponding to polysomes (3 fractions after the 80S monosome peak) were pooled and digested with RQ1 DNase (Promega) and cleaned-up using RNA Clean&Concentrator-5 kit (Zymo Research ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... To determine the optimum transfection ratio multiple complexes were created (1.5:1, 3:1, 6:1) using ViaFect Transfection reagent (Promega, E4981) and pGL4.51 [luc2/CMV/Neo] plasmid vector (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viabilities and Caspase 3/7 activities were measured via Cell Titer-Glo (CTG) Luminescent Cell Viability Assay (Promega, USA) or Caspase-Glo® 3/7 (Promega ...
-
bioRxiv - Immunology 2022Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and two of the aliquots were digested separately overnight using chymotrypsin (Mass Spectrometry Grade, Promega) or alpha lytic protease (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...