Labshake search
Citations for Promega :
1001 - 1050 of 4001 citations for HLA A*0201 WT 1 complex Protein Human HEK293 His since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Halo-fusion proteins were purified with Magne® HaloTag® Beads (Promega, USA) and then incubated with 50 ng ampDAP library ...
-
bioRxiv - Molecular Biology 2024Quote: ... The fusion proteins were directly purified using Magne Halo Tag Beads (Promega, USA). HaloTag–transcription factor fusion proteins were incubated with an adaptor-ligated genomic DNA library ...
-
bioRxiv - Biophysics 2024Quote: Proteins were translated in-vitro using the TnT Coupled Reticulocyte Lysate System (Promega). Constructs in a pcDNA3.1(+ ...
-
bioRxiv - Developmental Biology 2024Quote: ... The protein was purified under native conditions using MagneGST Glutathione Particles (Promega, #V861A). After annealing two complementary oligonucleotides (5’-AAAATACGAGGTCAGTCGTCACCTTTGCTTGCCCAGTTGTTTACTTCGTTTAAA -3’ and 5’-AAATTTAAACGAAGTAAACAACTGGGCAAGCAAAGGTGACGACTGACCTCGTAT -3’ for the Meox upstream region ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.
-
bioRxiv - Physiology 2021Quote: ... Plasmid DNAs coding for hSlo1 (AAB65837 in pCI-neo) and human β1 (AAH25707) or β4 (KJ893642) were transfected into the cells with either FuGene6 (Promega) or GenJet v ...
-
bioRxiv - Cancer Biology 2020Quote: ... Gene expression in the tumor was analyzed by using human primers using SYBR green gene expression assays (GoTaq qPCR Master Mix, A6002, Promega).
-
bioRxiv - Molecular Biology 2020Quote: A putative promoter region of 600bp encompassing the TSS of the human VDACs genes was selected from GenBank and cloned into pGL3 basic vector (Promega) for transcriptional activity study ...
-
bioRxiv - Molecular Biology 2021Quote: ... the sequences containing putative NRSE motifs were amplified by PCR from the human genomic DNA and then subcloned into the pGEM-T Easy vector (Promega). To generate plasmid templates for the mutated probes ...
-
bioRxiv - Molecular Biology 2020Quote: ... we isolated the sequence-paired sites from the native mouse and human Hes1 and Hes5 genes and cloned these fragments into the promoterless pGL3-Basic vector (Promega). Our synthetic promoters ...
-
bioRxiv - Neuroscience 2022Quote: The scATAC-seq peaks that overlapped obesity-associated SNPs were PCR amplified from human genomic DNA (see primers in Supplementary Table 2) and cloned into the pGL4.23 plasmid (Promega, E84111). The associated SNPs were then introduced into these plasmids by PCR amplification with primers containing the associated variants ...
-
bioRxiv - Molecular Biology 2022Quote: ... sequence was amplified from human genomic DNAs and used as in vitro transcription template in the reaction using Riboprobe System-T7 Kit (P1440, Promega) in the presence of 0.4μL 5-(3-Aminoallyl)-uridine-5’-triphosphate labeled with ATTO 680(Aminoallyl-UTP-ATTO-680 ...
-
bioRxiv - Biochemistry 2022Quote: ... GS-mediated GS-cAMP accumulation assays were performed with HEK293T (ATCC CRL-11268) cells transiently expressing human D1R or D5R wild-type and mutant along with the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20 000 cells/35 μL/well ...
-
bioRxiv - Molecular Biology 2023Quote: ... For ACE2 overexpression HEK293T cells were transfected for 24 h with human ACE2 (pCG1-hACE2, 200 ng DNA/well) using JetPrime (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... we amplified FES exons 9 to 11 with intervening sequences and SH3BP2 exons 9 to 11 with intervening sequences from human genomic DNA (Promega), and cloned the products into pcDNA3.1(+ ...
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends53 in pCI (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: HEK293T cells were transfected with a FLAG-tagged human DHHC20-expressing plasmid and a corresponding HA-tagged substrate-expressing plasmid using FuGENE transfection reagent (Promega) and incubated overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... 1,200 ng of ORs tagged with the first 20 amino acids of human rhodopsin (rho-tag) at the N-terminal ends in pCI mammalian expression vector (Promega) and 30 ng eGFP were transfected using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Neuroscience 2023Quote: Nine DIV hippocampal slice cultures were randomly assigned to treatment groups with the following drugs dissolved in serum-free medium: recombinant human BDNF (250 ng/mL, Promega); BDNF + K-252a (200 nM ...
-
bioRxiv - Genetics 2024Quote: Regulatory elements were amplified by PCR from human genomic DNA using primers listed in Supplementary Table 10 and cloned into the pGL4.23 Luciferase Reporter Vector (Promega, E8411) linearized with NheI and EcoRV (New England Biolabs ...
-
bioRxiv - Immunology 2024Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Biochemistry 2024Quote: Kinase reactions were performed on the recombinant human PER2 FASP or Degron using the ADP-Glo kinase assay kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Supernatants were then assayed for IL-1β (human; DuoSet; R&D) and relative LDH levels (as a surrogate for pyroptosis) using a CytoTox 96 Kit (Promega). For the THP-1 LPS signaling assays ...
-
bioRxiv - Immunology 2024Quote: ... Supernatants were then transferred to a 96-well plate for storage and assayed for IL-1β (human; DuoSet; R&D) and relative LDH levels using a CytoTox 96 Kit (Promega). Once supernatants were removed ...
-
bioRxiv - Cancer Biology 2024Quote: ... Supernatant was harvested after 3 days of co-culture and IFNγ secretion was analyzed using the Lumit human IFNγ Immunoassay (Promega) according to the manual and T-cells were analyzed for 4-1BB expression by flow cytometry.
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins bound to streptavidin-sepharose matrix were digested with trypsin (Promega, Madison, WI, USA) during 16 h or eluted for western blot analysis ...
-
bioRxiv - Genetics 2021Quote: The in vitro protein translations were performed using the TNT-assay (L4610) from Promega according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Tryptic digestion of proteins was carried out using porcine trypsin (Promega, GmbH, Mannheim, Germany). Trypsin solution prepared in 100 mM Ambic and 1 mM CaCl2 at a 0.01 μg/μl concentration and 100 μl added onto each sample for a final concentration of ~1.2 μg trypsin per sample containing 30 μg of total protein (trypsin to sample ration 1:25) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested with Lys-C (Wako Chemicals) overnight and trypsin (Trypsin Gold, Promega) for 6 hours.
-
bioRxiv - Molecular Biology 2020Quote: ... Protein pellets were resuspended in 8 M urea buffer combined with protease inhibitor (Promega) and purified using the chloroform-methanol precipitation method (Wessel & Flügge ...
-
bioRxiv - Biophysics 2022Quote: ... The purified Kif5B protein was incubated with 10 µM HaloTag PEG-Biotin ligand (Promega) for 30 min on ice to produce a final construct of Kif5B homodimer with two C-terminal biotin tags ...
-
bioRxiv - Immunology 2020Quote: ... IgG was purified from culture supernatant using Magne Protein A beads (Promega, Madison, WI) and the elution buffer exchanged with PBS using Amicon Ultra centrifugal filters (Millipore-Sigma ...
-
bioRxiv - Immunology 2021Quote: Proteins were in-gel digested with sequencing grade modified trypsin (Promega GmbH, Walldorf, Germany) similar to the procedure described by Pandey et al ...
-
bioRxiv - Neuroscience 2020Quote: ... samples containing 100 μg total protein were mixed with 100 μl Luciferase Substrate (Promega). The kinetics of the luminescence was recorded for 10 min using a TriStar2 S LB 942 Plate Reader (Berthold Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... The proteins were digested overnight at 37°C with Sequencing Grade Modified Trypsin (Promega) and the reaction was stopped by acidification ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested overnight at 37 °C by addition of 3 μg trypsin (Promega) and 2 μg LysC (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: Proteins were synthesized using TNT® SP6 Quick Coupled Transcription/Translation system (Promega L2080) using the standard reaction mix (rabbit reticulocyte lysate plus amino acids ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested for 18 h at 37°C with 0.5 μg trypsin (Promega). After digestion ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were digested for 18 hours at 37 °C with trypsin/LysC mix (Promega) at a protein-to-protease ratio of 25:1 ...
-
bioRxiv - Systems Biology 2020Quote: ... Proteins were digested for 18-24 hours on beads with sequencing grade trypsin (Promega) in 50 mM HEPES buffer at 1:50 trypsin to protein ratio for frozen tumors and 2 μg trypsin per 10 μm section of FFPE ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein extract was digested with trypsin (Catalog No. V5280, Promega, Madison, WI, USA) (trypsin ...
-
bioRxiv - Biophysics 2021Quote: Some protein kinase assays were performed using the ADP-Glo™ assay kit (Promega), which measures the generation of ADP in a kinase reaction ...