Labshake search
Citations for Promega :
1001 - 1050 of 2385 citations for 3 2 5 Dimethylphenyl 4' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 hr after stimulation using Nano-Glo® Luciferase Assay System (Promega). For each time point 200,000 cells were tested in triplicate for each cell line.
-
bioRxiv - Bioengineering 2021Quote: ... or PG48 at 5% molar ratio were incubated with trypsin gold protease (Promega) at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Each 5 μL fraction sample was treated with DNase I (cat #M6101, Promega) for 1 h at 37°C and then diluted 1:20 in 50 μg/mL yeast tRNA (cat #Am7119 ...
-
bioRxiv - Microbiology 2021Quote: ... the HIV 5′-UTR (nucleotides 1–497) was cloned into pSP72 vector (Promega) using BglII and EcoRI sites under the control of T7 promoter ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were then digested with 5 μg of trypsin (Promega, Sequence Grade). After an ON incubation at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µg of total RNA were treated with RQ1 RNase-free DNAse (Promega) for 2h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... and T7 RNA polymerase as well as 5 μL RNasin RNase inhibitor (Promega). Transcription reactions were left overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each reaction contained 5 μL of 2x SYBR Green mastermix (Promega, Benelux BV), 2.5 μL primer mix (forward and reverse ...
-
bioRxiv - Cancer Biology 2023Quote: ... Livers were incubated using Luciferase Cell Culture Lysis 5 x Reagent (Promega, E1531) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A total of 5 μL per well of 20x-NanoBRET Tracer K10 (Promega) at 10 μM for CSNK2A1 or 5 μM for CSNK2A2 in Tracer Dilution Buffer (Promega N291B ...
-
bioRxiv - Cell Biology 2024Quote: ... A total of 5 µL per well of 20x-NanoBRET Tracer K10 (Promega) at 5 µM in Tracer Dilution Buffer (Promega N291B ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were directly spiked with 5 pg of unmethylated lambda phage DNA (Promega) and subjected to bisulfite treatment and library construction using the post-bisulfite adaptor tagging (PBAT ...
-
bioRxiv - Cell Biology 2024Quote: ... RNAs were incubated with [5’-32P] pCp and T4 RNA ligase (Promega, M1051) O/N at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... 5 mg purified RIPR protein fragment was incubated with TEV protease (Sigma/Promega) at a 1:10 v/v ratio overnight at 4 °C on a rolling mixer ...
-
bioRxiv - Biochemistry 2022Quote: ... and impregnated with 75 µL of 5 ng/µL trypsin (trypsin gold; Promega) solution overnight at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... were digested with a modified MS grade trypsin (Promega; 1:5 enzyme/protein) overnight at 37 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... containing 5 μL di GoTaq® Green Master Mix (Promega, Madison, WI, USA), 1 μL of each primer 10 μM and 1 μL of template DNA and using a MyCycler Thermal Cycler (BioRAD ...
-
bioRxiv - Biochemistry 2024Quote: ... After incubating cells for 10 min with 5 μM coelenterazine-h substrate (Promega), bioluminescence was measured at 535/30 nm and 475/30 nm using a PHERAstar plate reader (BMG) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then resuspended in 4 ml DMEM/F12 + 80 μl DNase (1U/μl) (Promega M6101). The DNase solution was gently shaken by hand for 2–5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gel pieces were rehydrated in a mixture of 4 ng/µL trypsin (Promega, Madison, WI) and 0.01% ProteaseMAX (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by a 4 times dilution in Tris buffer and an overnight trypsin digestion (Promega) at a ratio 1/100 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Resuspended grindate was incubated (4°C, 20 min) with 660 U of DNase I (Promega). Insoluble cell debris was pelleted by spinning (16,000 g ...
-
bioRxiv - Biophysics 2021Quote: ... Cells were then incubated overnight at 4 °C with anti-p75NTR (Promega; G323A; 1:300) and anti-TRADD (Santa Cruz ...
-
bioRxiv - Cell Biology 2020Quote: ... Cultures were then incubated overnight at 4°C with either anti-β3-tubulin (Promega #G712A) or anti-Oct4 (Santa Cruz Biotechnologies #SC-5279 ...
-
bioRxiv - Cell Biology 2021Quote: ... Neurons were then incubated overnight at 4° C with anti-p75NTR (Promega; G323A; 1:500) and anti-TRAF6 (Santa Cruz ...
-
bioRxiv - Microbiology 2021Quote: ... 4°C) and then resuspended in 100 µl 1 x Passive Lysis Buffer (PLB, Promega). 45 µl of the luciferase assay substrate dissolved in Luciferase Assay Buffer II was plated on a 96-well plate and 10 µl of the cell lysate was added immediately before measurement of Fluc activity using a Tecan reader ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were digested using 4 μg of trypsin (sequencing grade, low autolysis trypsin; Promega), at 37 °C for 16 h ...
-
bioRxiv - Microbiology 2023Quote: ... 200 ml of media was treated with 4 U of RQ1 RNase-free DNase (Promega) for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA (4 μg) was reverse-transcribed using oligo-dT and the Reverse Transcription System (Promega). cDNA samples were diluted 1:10 and 5 μl of each sample were used for PCR reactions (final volume of 20 μl ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
bioRxiv - Genetics 2022Quote: ... cells were transfected with L1 reporter constructs using 4 μl FuGENE HD transfection reagent (Promega), 96 μl Opti-MEM (Life Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... Compound treatment was initiated 1-4 hours before transfections with FuGENE HD transfection reagent (Promega) following the manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... Fisher) containing 4% FBS with or without HaloTag NanoBRET 618 Ligand (Cat. No. PRN1662, Promega) and incubated overnight at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
HIVtat Alters Epithelial Differentiation State and Increases HPV16 Infectivity in Oral KeratinocytesbioRxiv - Microbiology 2023Quote: ... 200 ml of media was treated with 4 U of RQ1 RNase-free DNase (Promega) for 1 hour at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... and transfected with 20µL of transfection mixture at 4:1 ratio of Fugene HD (Promega) to DNA in Optimem (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Cells were fixed with 4% paraformaldehyde and permeabilized in 0.5% Triton X-100 (Promega, H5142) prior to staining ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 1 nM of DNA and 4%(v/v) Green-Lys tRNA (FluoroTect GreenLys, Promega, USA) were added to the assembled PURE and incubated for 4h at 37 °C in a PCR thermocycler (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...