Labshake search
Citations for Promega :
951 - 1000 of 1661 citations for Mouse MOB1B shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse Anti-LgBiT monoclonal antibody was purchased from Promega (cat. #N7100), HRP-linked anti-mouse IgG was used as a secondary antibody and purchased from Cell Signaling Technology (7076S) ...
-
bioRxiv - Microbiology 2024Quote: ... Mouse antibodies (CV801, CV804, CV820, CV925, CV1117) and effector cells (Promega) expressing mouse FcγRIV and NFAT luciferase reporter were added to the cells ...
-
bioRxiv - Biochemistry 2024Quote: ... and anti-mouse IgG HRP conjugate (W4021; Promega, Madison, WI, USA) as secondary antibodies for 1.5 to 2.0 h at room temperature with gentle shaking ...
-
bioRxiv - Biochemistry 2024Quote: ... An anti-mouse IgG-horseradish peroxidase (HRP) conjugate (1:3,000 Promega) was used as secondary antibody ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-mouse IgG (H+L) HRP conjugate (Promega #W4021, 1:10000), anti-rabbit IgG (H+L ...
-
bioRxiv - Neuroscience 2021Quote: ... Either pCAGIG-Emx2 or pCAGIG were cotransfected with pNfib or the control pGL4.23 luciferase reporter plasmid (Promega) using FuGENE HD (Promega) ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA plasmids or dsRNAs were transfected into the cells using FuGene HD transfection reagent (Promega, Cat #PRE2311) according to the manufacturer’s protocol.
-
bioRxiv - Genomics 2019Quote: ... of the relevant pCpGL-EF1 plasmid and 6ng (DNA methylation) or 1.5ng (SOX9 overexpression) of pRL-TK Renilla control plasmid and 0.3μl FuGeneHD reagent (Promega) per well ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid transfection of U2OS cells with PIF1 variants was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Biophysics 2021Quote: ... the cells were transfected with 1 – 2 μg EphA2-mTurquoise plasmid DNA using FuGene HD (Promega, #E2311) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... pMAD-AB plasmid was also digested with MluI and BamHI and dephosphorylated by addition of TSAP (Promega, streamlined restriction digestion protocol ...
-
bioRxiv - Cell Biology 2021Quote: Yeast expression plasmids were purified from ~5ml saturated cultures using a Wizard® DNA Purification System (Promega) and were transformed into competent yeast ...
-
bioRxiv - Microbiology 2020Quote: ... coli isolates was extracted using Wizard® Plus SV Mini preps plasmid DNA Purification kit (Promega, USA) according to manufacturer’s instruction and was electrophoresed in 0.8% agarose gel (Rakhi et al. ...
-
bioRxiv - Microbiology 2020Quote: ... HRE3 and HRE4 were cloned into the luciferase reporter plasmid pGL3-basic vector (Promega Corporation, Madison, WI).
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected with 500 ng of either HDM-SARS-Spike-delta21 or HDM_Spike_RBD_B7-1 plasmids and 1.5 ng of Transfection Carrier DNA (Promega, E4881) using BioT reagent (Bioland Sci ...
-
bioRxiv - Plant Biology 2020Quote: ... The isolation of plasmid DNA was performed with the Wizard Plus SV Minipreps DNA Purification System (Promega). The insert of the purified plasmid DNA was sequenced using the standard primers T7 and SP6.
-
bioRxiv - Microbiology 2020Quote: ... Plasmid DNA was obtained by extracting with a Miniprep Kit (Pure Yield™, Promega, Madison, WI, USA), and pET-15b_peiW was transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: ... and pCMVΔ8.9 plasmids were co-introduced into human embryonic kidney 293T cells using the FuGENE reagent (Promega). 48 h after transfection ...
-
bioRxiv - Immunology 2021Quote: ... Ligation was performed on gel purified insert and digested plasmid with T4 Ligase (Promega, Madison, WI, USA) according to manufacturer’s instructions ...
-
Herpes simplex virus 1 entry glycoproteins form stable complexes prior to and during membrane fusionbioRxiv - Microbiology 2022Quote: ... and Sm- and Lg-BiT plasmids for tagging proteins of interest were purchased from Promega (Madison, WI) [48] ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid DNA was isolated from bacterial cells using commercial Wizard Plus SV Minipreps DNA Purification kit (Promega) or the QIAprep Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: shERH plasmids were diluted in 500 μl of OPTI-MEM with 15 μl of Fugene HD (Promega) and mixed well with rapid pipetting ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 μg of a plasmid expressing the VSV G glycoprotein using the FuGene HD reagent (Promega). Forty-eight hours later ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... cells were transfected with human RXFP1 pcDNA-Zeo-tetO and the GloSensor reporter plasmid using FuGENE (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3’UTR-Nogo-A-wt product was subcloned into both the pGEM-T-easy plasmid (Promega) and the pBKS plasmid (pBluescript ...
-
bioRxiv - Cancer Biology 2022Quote: ATRX knock-out clone were established by transfecting SK-N-AS and GI-ME-N with the Cas9 expressing vector containing ATRX_KO_sgRNA_2 (targeting exon 4) and the corresponding homology arm plasmid using Fugene HD transfection reagent (E2312, Promega). Three days after transfection ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The plasmid for β-arrestin-2 fused at the N-terminus to LgBiT was obtained from Promega custom assay services (plasmid CS1603B118) ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were washed again and 6 µg of plasmid DNA was added with FugeneHD transfection reagent (Promega). Supernatants were collected at 24 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... All reactions contained 13.4 ng of the AHR-responsive pGudLuc6.1 luciferase reporter plasmid and 1.0 ng of pTK Renilla (Promega). The pGudLuc6.1 plasmid uses the AHR-responsive domain from the upstream region of the mouse CYP1A1 gene to drive firefly luciferase expression (Han ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Plasmid DNA was isolated by means of the Wizard® Plus SV Minipreps DNA Purification system (Promega). E ...
-
bioRxiv - Immunology 2020Quote: ... with addition of PSCA-mCAR or ffluc retrovirus backbone plasmid DNA using FuGENE HD transfection reagent (Promega). Viral supernatants were collected after 24 ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were transfected with 50 ng of plasmids encoding the HiBiT-tagged proteins using FuGENE HD (Promega). Cells were trypsinized (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... following manufacturer’s guidelines and a ratio of 0.5 µg of plasmid:1.5 µL FuGene 6 (Promega, E2691) in Opti-MEM (Gibco) ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was prepared from bacterial cultures grown at 37 °C using PureYield™ Plasmid Midiprep System (Promega) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... or let7A2 generated in the laboratory and with 50 ng of pRL-TK Renilla luciferase plasmid (Promega). ...
-
bioRxiv - Bioengineering 2020Quote: ... DNA was purified using the Pure Yield Plasmid Midiprep system kit (Promega, WI, US Cat. No. A2492). DNA quality and concentration were determined by measuring the ratio of signals at wavelengths of 260 and 280 nm using a NanoDrop instrument (Thermo Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... the EGFP coding sequence was PCR amplified from the plasmid pDestattB_ubi:EGFP using GoTaq® DNA Polymerase (Promega) with attB-P2A-EGFP-F and pA-r primers (Supplementary Table S3) ...
-
bioRxiv - Immunology 2022Quote: The protein sequences of the selected seven Listeria genes were cloned into a pGEM4z-plasmid vector (Promega) containing a T7 promoter ...
-
bioRxiv - Cancer Biology 2023Quote: ... in the presence of 150 ng of pRL-TK-Renilla luciferase plasmid (Promega, Charbonnières-les-Bains, France). After 48h incubation with Doxycycline ...
-
bioRxiv - Molecular Biology 2023Quote: Full-length VHL was obtained as plasmids cloned in frame with a terminal NanoLuc-fusion (Promega, ND2700). The plasmid was transfected into HEK293T cells using FuGENE HD (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... Linear plasmids were transcribed in vitro using the T7 RiboMAX Express Large Scale RNA Production System (Promega) using ‘half sized’ reactions whereby 250 ng linear plasmid was added to a reaction mixture using half the volume suggested for all reagents in the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and processed using the PureYield Plasmid Miniprep System according to the manufacturer’s directions (Promega, Cat. No. A1222).
-
bioRxiv - Microbiology 2023Quote: ... and 0.25 μg vesicular stomatitis virus G glycoprotein expression plasmids using the Fugene 6 transfection reagent (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 μg sHLA plasmid) were added to OptiMEM media with 9 μL FuGENE HD Transfection Reagent (Promega) at a 3:1 FuGENE:DNA ratio ...
-
bioRxiv - Developmental Biology 2023Quote: ... eGFP coding sequence was replaced by HaloTag (pFN23K-Halo plasmid, given by St Jonhston lab, Promega G2861), amplified using primers CACCTAGGATGGCAGAAATCGGTACTGGCTTTCCATTCGACC and CTACGCGTTGCCGGAAATCTCGAGCGTGG for Su(H)::Halo ...
-
bioRxiv - Cancer Biology 2023Quote: Luciferase reporter plasmids were constructed using the pmiRGLO Dual-Luciferase miRNA Target Expression Vector (Promega, Dübendorf, Switzerland) 16 ...
-
bioRxiv - Genetics 2023Quote: ... from HEK293A cells transfected with CROPseq-EFS-SpCas9-P2A-EGFP DNMT3B sgRNA plasmid using Fugene HD (Promega). PCR fragment for SURVEYOR assay was amplified using Q5 high-fidelity polymerase using the primers F ...
-
bioRxiv - Cell Biology 2023Quote: ... or mutant β2AR INTAL and a plasmid encoding a cyclic-permuted luciferase reporter construct (pGloSensor-20F, Promega) and luminescence values were measured ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Genetics 2022Quote: ... The digested plasmid was purified using the Wizard SV Gel and PCR Clean-Up System (Promega A9281). The zebrafish exorh promoter region was amplified from pCK029 (this manuscript ...