Labshake search
Citations for Promega :
951 - 1000 of 6143 citations for Cortisone Chemiluminescent ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... Dual-luciferase reporter gene assay kit (Promega, Beijing, China) was used to measure activities of Luciferase ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesised (AMV Reverse Transcriptase kit, Promega, Southampton, UK) and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... with the Maxwell® RSC Blood DNA kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Cell Titer Glo Luminescent Cell Viability Assay Kit (Promega) was used and subsequently performed after the BRET measurement ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the Maxwell DNA LEV Blood Kit (Promega #AS1290) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... purified using a Wizard Genomic DNA Purification kit (Promega), and sent for Sanger sequencing (ACGT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Triglyceride-Glo™ Assay kit (Cat#J3160, Promega) from Promega were used according to user’s manual ...
-
bioRxiv - Microbiology 2019Quote: ... coli S30 Extract system for Linear Templates kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: Wizard Genomic DNA purification kit (Promega, Madison, WI, USA) (Catalog NO. ...
-
bioRxiv - Immunology 2019Quote: ... and Caspase-Glo® 3/7 assay kit (Promega). A volume of 100 μL cells was placed in a 96-well plate ...
-
bioRxiv - Physiology 2019Quote: ... cDNA was synthesized using a Reverse Transcriptase kit (Promega). Quantitative real-time PCR was conducted using primer sets in Supplementary Table 1 and mRNA levels were analyzed in duplicate using SYBR green (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell viability was determined using the CellTiterGlo kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and purified with the Wizard SV Gel kit (Promega). The purified DNA was incubated with DpnI (New England BioLabs® ...
-
bioRxiv - Cancer Biology 2019Quote: ... Luciferase activities were measured with Luciferase assay kit (Promega) and were normalized with protein concentrations of samples.
-
bioRxiv - Genetics 2021Quote: ... using the Maxwell 16 Tissue DNA Purification kit (Promega). The ddRAD-seq library was constructed using all the genomic DNAs according to the method described in Peterson et al ...
-
bioRxiv - Plant Biology 2020Quote: ... The GoTaq qPCR Master Mix Kit (Promega Corporation, USA) was used for the gene expression profiling ...
-
bioRxiv - Microbiology 2021Quote: ... In vitro transcription reactions (Promega MegaScript T7 transcription kit) containing ∼400 ng of the purified PCR product ...
-
bioRxiv - Molecular Biology 2019Quote: ... Viability was determined using the CellTiter-Glo Kit (Promega) as per manufacturer’s recommendations ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Luciferase expression was measured using the DualGlo Kit (Promega). Firefly luciferase signal was normalized to Renilla luciferase signal in each well ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the LDH CytoTox 96 kit from ProMega (Madison, WI), Urea Nitrogen Test from StanBio Laboratory (Boerne ...
-
bioRxiv - Molecular Biology 2019Quote: ... the plasmid was recovered using a miniprep kit (Promega), DpnI digested and transformed into MBM7070 indicator bacteria ...
-
bioRxiv - Microbiology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... cAMP-Glo™ Assay kit (Promega, Cat. no. V1501) was used to measure cellular cAMP levels via GloMax® Discover Microplate Reader (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... with Maxwell® RSC simplyRNA Tissue Kit (AS134, Promega), following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell lines were either fingerprinted (PowerPlex 1.2 Kit, Promega) or independently authenticated annually (ATCC ...
-
bioRxiv - Microbiology 2021Quote: ... or Maxwell 16 LEV simplyRNA cell kit (Promega; #AS1270), respectively ...
-
bioRxiv - Molecular Biology 2021Quote: ... Assays were performed using the dual luciferase kit (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... using the Dual-Luciferase Reporter Assay Kit (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Alkaline Phosphatase development kits were purchased from Promega (S3771), and OP9 stains were performed according to manufacturer’s instructions in lightly fixed cells (4%PFA for 1 minute at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Dual luciferase assay system kit (Promega, Madison, WI, USA) was used following manufacturer’s protocol as described previously51.
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted using Maxwell RNAeasy kit (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ATP levels were evaluated using the BactiterGLO kit (Promega) per manufacturer’s specifications and normalized to protein content in the cell pellet as determined using a Bradford assay.
-
bioRxiv - Microbiology 2022Quote: ... and associated Maxwell RSC cultured cells DNA kit (Promega). DNA concentration was quantified using the Qubit 3.0 fluorometer for dsDNA broad range assay kit (Thermo Fisher Scientific) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... the Cell Titer Glo One solution kit from Promega was used ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... the Cell Titer Glo One solution kit from Promega was used ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... the Cell Titer Glo One solution kit from Promega was used ...
-
bioRxiv - Neuroscience 2022Quote: ... or Maxwell® RSC simplyRNA Tissue Kit (Promega, AS1340) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: A Cytox 96 Non-Radioactive Cytotoxicity Assay Kit (Promega) was used to measure the activity of lactate dehydrogenase (LDH ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... using the GoTaq® qPCR Master Mix kit (Promega) in 384-well plates ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: In vitro-translated ERRα full length (TNT kit; Promega) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Dual-GLO®Luciferase Assay System Kit (Promega). Firefly luciferase activities were normalized to Renilla luminescence in each well.
-
bioRxiv - Molecular Biology 2022Quote: ... or by qPCR (ProNex NGS Library Quant Kit, Promega). DNA libraries were sequenced on Illumina NextSeq 500 or Illumina MiSeq platforms.
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using PCR cleanup kit (Promega). Sanger sequencing was performed at Psomagen ...
-
bioRxiv - Bioengineering 2023Quote: Wizard Genomic DNA Purification Kit (Promega cat. no. A1125)
-
bioRxiv - Cancer Biology 2023Quote: ... using a Dual-Glo luciferase kit (Promega, Cat# E2920) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were authenticated using the GenePrint 24 kit (Promega) at the DNA Sequencing Core Facility ...
-
bioRxiv - Immunology 2023Quote: ... the MultiTox-Glo Multiplex Cytotoxicity Assay kit (Promega, G9272) was used according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genomic DNA was extracted (ProMega Wizard Genomic DNA kit) and barcoded with a Nanopore technologies rapid barcoding kit ...