Labshake search
Citations for Promega :
951 - 1000 of 2225 citations for 6 Hydroxy 5 2 phenyldiazenyl 2 naphthalenesulfonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... for 2 hours at 72 hours and lysed at 98 hours using 25 μl Dual-Glo® Luciferase Assay System (Promega). Luminescence was measured ...
-
bioRxiv - Immunology 2023Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Microbiology 2023Quote: The assay was adapted from 15 where Hyp1-Nluc schizonts at 1% hematocrit and 1-2% parasitaemia were lysed in 1x NanoGlo buffer (Promega, USA) within a 96-well flat-bottom plate and parasite lysates were added to compounds and incubated for 10 minutes at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 µL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 µL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of furimazine substrate was added to the reaction well from a working reagent stock of a 2:100 NanoDLR Stop & Glo Substrate to Buffer ratio (Promega #N1610). A total well volume of approximately 112.5 μL was incubated at room temperature for 2 minutes prior to measuring luminescence and OD600 readings on an EnVision plate reader (PerkinElmer).
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:5000 in 2% BSA in TBST) for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).
-
bioRxiv - Cell Biology 2023Quote: ... the 200k pellets were digested for 2 h at 37°C with 0.4 µg of Trypsin/Lys-C (Promega CAT#: V5071) and then overnight by adding 0.4 µg of Trypsin/Lys-C ...
-
bioRxiv - Genetics 2023Quote: ... After adding 2 µg MS grade trypsin in the intraspecific hybrids (Pierce Biotechnology, Waltham, MA) and polyploids (Promega Corporation, Madison, WI) to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 µg of bacmid DNA were used to transfect Sf21 cells for baculovirus generation using FuGENE® transfection reagent (Promega). The protein was expressed in Lonza Insect-EXPRESS™ medium for 72-96 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Levels of reporter mRNAs in eggs were measured 6 hrs post-injection by RT-qPCR using the GoTaq 2-Step RT-qPCR system as per manufacturer’s instructions (Promega, Madison, WI) with random primers for reverse transcription and oligos listed in Table 1 for the qPCR step.
-
bioRxiv - Neuroscience 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, # V5117) directly on top of the column and incubating overnight at 37 °C ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 2 µl of the lysed samples were added to 25 µl PCR reactions with GoTaq Green mastermix (Promega, Cat. No. M7123). After amplification ...
-
bioRxiv - Physiology 2024Quote: ... further steps were performed according to the manufacturer’s protocol using proteases trypsin and Lys-C (2 h at 47° C, 1:15 and 1:30, respectively, Promega, USA). Peptides (20 μg ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of RNA was used astemplate to generate cDNAs using the ImProm-II Reverse Transcription system (Promega, Madison, Wisconsin, USA). qPCR reactions were carried out on an MX3000P system (AgilentTechnologies ...
-
bioRxiv - Microbiology 2024Quote: ... Contaminating DNA in the samples were removed through incubation at 37°C for 2 h using RNase-free DNase I (Promega, USA). All RNAs in the samples were converted into cDNA using a cDNA EcoDry Premix (Clontech ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 ml ice-cold wash buffer 1 (1x PBS with 2 % BSA, 1 mM DTT and 0.5 U/µl RNasin® Plus Ribonuclease Inhibitor - Promega #N2615) was added and cells were spun at 500 g for 3 min at 4 C ...
-
bioRxiv - Microbiology 2024Quote: ... A 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based viability assay (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega) was performed as previously described (25).
-
bioRxiv - Cell Biology 2021Quote: ... Briefly 70-90% confluent cells in 6-well plated were transfected with 1 µg CRISPR/Cas9 plasmids per well by using FuGENE 6 (Promega, Madison, Wisconsin). After 24 h post-transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with 36 µL FuGENE 6 (Promega) and 12 µg of retroviral plasmid DNA ...
-
bioRxiv - Cell Biology 2019Quote: ... whereas SKBr3 cells were transfected using Fugene 6 (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transfection was performed with FuGENE 6 transfection reagent (Promega). All the cell lines were regularly confirmed to be free of contamination (e.g ...
-
bioRxiv - Molecular Biology 2021Quote: HEK-293T cells were transfected using Fugene 6 (Promega), Lipofectamine LTX ...
-
bioRxiv - Cell Biology 2019Quote: ... Digestion was with 6 ng/μl trypsin (Promega, UK) overnight at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... and 6 ng/μl of sequencing grade trypsin (Promega) for 1 h at 50 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... pKIF1CP176L-GFP or pKIF1CR169W-GFP using Fugene 6 (Promega) in fibronectin-coated glass-bottom dishes and imaged 24 hours later on an Olympus Deltavision microscope (Applied Precision ...
-
bioRxiv - Cell Biology 2021Quote: hTert-RPE1 cells were transfected using FuGENE 6 (Promega) according to the manufacturer’s instructions at a ratio of 1:3 ...
-
bioRxiv - Cancer Biology 2021Quote: ... or the FuGENE 6™ (Promega, Fitchburg, WI, USA) transfection reagents according to the suppliers’ instructions for 1-2 days before the experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... then 6 μL FuGENE HD Transfection Reagent (Promega, USA) was added and vortexed to obtain a 3:1 reagent-to-DNA ratio ...
-
bioRxiv - Immunology 2022Quote: ... by transfection using Fugene 6 (Promega, catalog no. E2692) and a combination of S plasmid ...
-
bioRxiv - Immunology 2022Quote: ... and p MD.2G using Fugene 6 (Promega, PAE2693) in HEK293T cells ...
-
bioRxiv - Genetics 2022Quote: ... The transfection mix was prepared using Fugene 6 (Promega) at 3µl/ug DNA in 500µl (total volume ...
-
bioRxiv - Bioengineering 2020Quote: ... and 42 μL FuGENE 6 (Promega, Cat. No. E2691). The tube was gently flicked to mix the plasmids before and after the addition of FuGENE 6 ...
-
bioRxiv - Immunology 2021Quote: ... and 1 μg shRNA plasmid using Fugene 6 (Promega). The next day ...
-
bioRxiv - Biochemistry 2020Quote: ... Transfections were carried out by using Fugene 6 (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... or FLAG-KrascomQ61R using FuGene 6 reagent (Promega, E2691) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... HEK293 cells were transiently transfected using Fugene 6 (Promega) with GFP-Tnf 3’UTR reporter constructs and a pGL3-mCherry control construct ...
-
bioRxiv - Cell Biology 2021Quote: ... Digestion was with 6 ng/μl trypsin (Promega, UK) overnight at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected using FuGENE 6 (Promega, Madison, WI) or lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... and 18 μl of FuGENE 6 transfection reagent (Promega), according to manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2024Quote: ... and 2.8 μL transfection reagent Fugene 6 (Promega, PRE2693). After a 24-h incubation ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmid DNA transfections were performed using FuGENE 6 (Promega), Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transfected using FuGENE® 6 reagent (Promega) combined with 12 μg of the indicated plasmid cDNA construct ...
-
bioRxiv - Microbiology 2023Quote: ... 6 washes were performed before adding the trypsin (Promega) at 1/20 ratio for 2h at 47°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 30 μL of CellTiter Glo (Promega, diluted 1:6), was added to each well and luminescence was measured with an Envision plate reader ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... was combined with 9.6 μL FUGENE 6 (Promega #E2691) and incubated for 5 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... For the Caspase-Glo 3/6 Assay (Promega #G8092), Caspase-Glo 3/7 reagent was added to the cells ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acid was recovered using the Maxwell RSC instrument (Promega). After DNAse treatment and elution ...