Labshake search
Citations for Promega :
51 - 100 of 1013 citations for Siglec 5 Human HEK293 His Flag Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... His-tag proteins have been purified by using MagneHis system (Promega) and DynaMag spin magnet (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2019Quote: ... These cells were then transfected with 50 ng of pcDNA3-STING-HA and 500 ng of either pcDNA3-FLAG-HA or pcDNA3-FLAG-HA-SLC19A1 using FuGENE 6 transfection reagent (Promega). After 24 h ...
-
bioRxiv - Biochemistry 2020Quote: ... cDNAs were obtained from Origene in pCMV6 vector that also incorporates C-terminal Myc and FLAG tags (Myc-FLAG) or subcloned into a pHTC (Promega)-derived vector that expresses C-terminal HaloTag (41) ...
-
bioRxiv - Immunology 2019Quote: MSR1 KO BMDMs were transfected either with 1 μg of pCMV WT-MSR1-FLAG or pCMV MSR1-(K27R)-FLAG using Fugene (Promega) transfection agent for 24 hrs ...
-
bioRxiv - Molecular Biology 2019Quote: ... and pLenti RACK1-FLAG using Fugene HD (Promega). The lentivirus-containing media was filtered through a 0.45 μm PES filter ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Immunology 2021Quote: ... Luciferase activity in infected hACE2-HEK293 cells was measured with a Bright-Glo Luciferase assay system (Promega) and a Beckman Coulter DTX880 plate reader ...
-
bioRxiv - Biophysics 2020Quote: ... Changes in the intracellular cAMP concentration of the HEK293 cells were measured by the GloSensor assay (Promega). The transfected cells were incubated with or without 0.5 μM all-trans-retinal (Toronto Research Chemicals) ...
-
bioRxiv - Biophysics 2021Quote: ... Constructs (2 μg) were transfected into HEK293 cells on glass coverslips using Fugene HD (Promega, Madison, WI) per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293 cells were washed with 1X PBS buffer and then lysed with 1X passive lysis buffer (Promega). The cells were cleared of any cell debris by centrifugation at 14000 rpm for 10 min at 4°C ...
-
bioRxiv - Immunology 2022Quote: The Flag-TRAF6 preparations eluted from FLAG resin with 3X FLAG peptide were digested with a combination of trypsin and Lys-C protease (Promega, #V5071) using S-trap mini columns (Protifi ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were blocked with PBS containing 5% skim milk and incubated with HRP-conjugated anti-human IgG1 antibodies (Promega, #W403B) overnight at 4 °C.
-
bioRxiv - Cancer Biology 2021Quote: ... or FLAG-KrascomQ61R using FuGene 6 reagent (Promega, E2691) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2023Quote: HEK293 cells stably expressing μOR or μOR-APEX2 were transiently transfected with the cAMP biosensor pGLO-20F (Promega). Prior to agonist stimulation ...
-
bioRxiv - Cancer Biology 2021Quote: ... 19.5µl of nuclease-free water) (FC-121-1030, Illumina; G9441, Promega). Transposition reactions were incubated at 37°C for 30 minutes in an Eppendorf ThermoMixer with agitation at 1000 RPM ...
-
bioRxiv - Biochemistry 2021Quote: ... The 3xFlag-m-PKD1-2xMyc/His insert was subcloned into pCI vector (Promega). To produce CTF expression constructs of human (h ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated for 24-48hrs in the blocking solution containing chicken anti-human NT-4/5 antibody (10 mg/ ml, Promega, Madison, WI) or rabbit anti-human NT-4/5 (1:1000 ...
-
bioRxiv - Bioengineering 2019Quote: ... cells were transfected using FuGene HD transfection reagent according to their standard protocol for HEK293 cells (Promega, Madison, WI). DNA plasmids were cloned in Dam-negative E ...
-
bioRxiv - Immunology 2020Quote: ... The sleeping beauty transposon system was stably transfected into HEK293 EBNA cells using FuGENE® HD (Promega GmbH, USA) in DMEM/F12 (Merck ...
-
bioRxiv - Biochemistry 2023Quote: The recruitment of PTH1R to β-arrestin was detected in HEK293 cells using the NanoLuc Binary System (NanoBiT; Promega). The Lgbit subunit was fused to the C-terminus of PTH1R and the SmBiT subunit was fused to the N-terminus of β-arrestin ...
-
bioRxiv - Developmental Biology 2023Quote: ... HEK293 culture medium was replaced by imaging medium containing either Janelia Fluor 646 (JF646) ligand (10 nM; Promega, #GA1120) or OregonGreen ligand (50 nM ...
-
bioRxiv - Biochemistry 2023Quote: BromoTag cell lines were generated in HEK293 cells via simultaneous transfection of two vectors at a 4:1 reagent:DNA ratio with FuGENE 6 (Promega). The first vector was a pMK-RQ vector containing 500 bp homology arms on either side of either an eGFP-IRES-BromoTag or eGFP-IRES-HiBiT-BromoTag sequence for integration into MCM4 and BRD4 ...
-
bioRxiv - Immunology 2022Quote: ... into 293T cells in DMEM medium + 10% FCS using Fugene 6 (Promega) for pseudoviruses production ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
bioRxiv - Cell Biology 2019Quote: Approximately 5 × 107 control cells and 2 × 107 sort3 PIGS-KO HEK293 cells were used for genomic DNA extraction by Wizard Genomic DNA Purification Kit (Promega). Approximately 325 µg of genomic DNA from control cells and 30 µg of genomic DNA from sort3 cells were used for amplification of gRNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... Virus-like particles (VLPs) containing the GFP control or targeting sgRNAs were generated by transfection of HEK293 cells with FuGene (Promega). VLPs were collected from culture supernatant ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant DJ-1 protein (1 μM) was added to the transfected HEK293 cell lines and luciferase activities were measured using a Luciferase Assay System (Promega). 10 μg mL−1 of peptidoglycan (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... 3 μg of psPAX2 packing plasmid and 2 μg of pM2G envelope plasmid were transfected into HEK293 Lenti-X cells using 30 μL of Fugene-HD (Promega) in antibiotic-free DMEM ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 HEK293 cells were plated in 15cm petri dishes and transfected the day after with 50 μL FuGENE (E2311, Promega), 10 μg CAR-encoding vectors and 3.3 μg of each 3rd generation lentivirus helper vectors (CART-027CL ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells in a 6-cm dish were transiently transfected with 1 μg of pGloSensor-22F cAMP plasmid (Promega, USA) and 1 μg of human wild-type or mutated A2AR or A2BR overexpression plasmid using polyethyleneglycol (6 μl ...
-
bioRxiv - Immunology 2023Quote: ... and the corresponding SARS-CoV-2 spike construct were co-transfected in HEK293-T cells using FuGENE 6 Transfection Reagent (Promega) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Immunology 2022Quote: ... 5×106 HEK293 cells were plated in 15 cm petri dishes and transfected the day after with 50 μL FuGENE (E2311, Promega), 10 μg CAR-encoding vectors and 3.3 μg of each 3rd generation lentivirus helper vectors (CART-027CL ...
-
bioRxiv - Molecular Biology 2024Quote: ... The -1 PRF efficiency was assayed in cultured HEK293 as described previously (Kelly et al. 2020) using dual-luciferase reporter assay system kit (Promega). 24 hr post transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... pcDNA vectors (pcDNA-TruB1-Flag) were transfected with FuGENE HD (Promega) into cells according to the Manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... or Flag-eGFP-puro were transfected using Fugene HD (Promega E2311). On the following day ...
-
bioRxiv - Systems Biology 2020Quote: ... Human cell lysate (MS Compatible Human Protein Extract, Digest, V6951) were purchased from Promega.
-
bioRxiv - Neuroscience 2020Quote: ... All designed probes were tested by ddPCR using human genomic DNA (Human male, Promega) as a negative control ...
-
bioRxiv - Microbiology 2020Quote: Plasmids encoding each vector were transfected into HEK293 cells seeded in 10 cm plates using Fugene 6™ (Promega, Madison, WI) or polyethyleneimine ...
-
bioRxiv - Immunology 2022Quote: ... HEK293 cells were transfected with the ORF8 plasmid together with the transposase coding plasmid (1/10) with Fugene HD (Promega, Germany) and after one day selected with 3 µg/ml puromycin for three days ...
-
bioRxiv - Neuroscience 2021Quote: Luminescence assays to monitor cAMP levels were performed as we described previously (Siuda et al., 2015). Briefly, HEK293 cells (ATCC, cat. # CRL-1573) were co-transfected with PPO-Venus and pGloSensor-22F (Promega E2301) plasmids using JetPrime reagent (Polyplus ...
-
bioRxiv - Molecular Biology 2023Quote: ... NLS-NSD2-mVenus WT and T1150A plasmids were transfected into 70 % confluent HEK293 SETD2 knockout cells using FuGENE® HD Transfection Reagent (Promega). NLS-mVenus empty vector was used as a negative control ...
-
bioRxiv - Molecular Biology 2023Quote: ... a mixture of the 3 Cas9-sgRNA plasmids (150ng/μl) was transfected into HEK293 cells at 70% confluency in fresh medium using FuGENE® HD Transfection Reagent (Promega). Two days after transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... hiPSC-aCM or HEK293 cells were incubated with a labeling solution containing both cell-impermeant HTL-Alexa488 (Promega G1001, 1 µM) and Cellmask Deep Red Plasma Membrane stain (Invitrogen C10046 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Human Genomic DNA (G1521, Promega) was used as positive control and synthetic DNA was used to validate the LAMP assay performance ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1.5-6ng pcDNA3.1 FLAG-cGAS and STING using 0.75μl FuGENE 6 (Promega) and 20μl Opti-MEM (Promega) ...
-
bioRxiv - Biochemistry 2021Quote: ... HEK293 cells were transfected with a PPRE-firefly luciferase reporter plasmid together with phRL-TK Renilla luciferase control vector (Promega, Madison, WI), pCMX-PPARα ...
-
bioRxiv - Microbiology 2019Quote: ... 5 μl of 5× Gotaq buffer (Promega M792A), 1μl of 10μM forward primer ...
-
bioRxiv - Microbiology 2020Quote: ... 500 ng human genomic DNA (Promega) or 5 μl of untreated or RNase-treated nasal swab nucleic acid isolates ...
-
bioRxiv - Cancer Biology 2020Quote: ... Pooled human male genomic DNA (Promega) was randomly sheared (500-800bp ...
-
bioRxiv - Systems Biology 2021Quote: ... a human cDNA pool (Promega Corporation), or obtained as synthesized double-stranded DNA fragments (gBlocks ...