Labshake search
Citations for Promega :
51 - 100 of 109 citations for S R S AHPC C8 NH2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Germany) for 2.5 s by adding 20 μL of Nano-Glo® substrate in assay buffer (Promega Inc, WI, USA). Uninfected monolayer of Vero cells treated identically served as controls to determine basal luciferase activity for obtaining normalized relative light units ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... princeps luciferase enzymatic activity due to luciferase reconstitution was measured on a Centro XS LB960 microplate luminometer (Berthold Technologies) using a reading time of 10 s after injection of 50 µl Renilla luciferase reagent (Promega). Mean relative light units (RLUs ...
-
bioRxiv - Neuroscience 2023Quote: ... luminescence photons were collected by accumulating the image for 60 s in the presence of 2 mM D-luciferin (Promega), and the luminescence signal was measured from the same varicosities as the corresponding fluorescence image ...
-
bioRxiv - Cancer Biology 2023Quote: ... samples resuspended in 5%SDS buffer were reduced with DTT and alkylated, followed by digestion on a S-Trap column (ProtiFi, LLC)with sequencing-grade Lys-C/trypsin (Promega). The resulting peptides were were analyzed with a nanoAcquity UPLC system (Waters ...
-
bioRxiv - Biochemistry 2021Quote: ... import assays of the comparatively higher molecular weight ACE2 and S proteins (50 μL reactions) were both performed using the TNT® Coupled Transcription/ Translation system (Promega) for 90 min at 30°C as described by the manufacturer (∼50 ng/μL cDNA,1 μM Ipom-F or an equivalent volume of DMSO ...
-
bioRxiv - Plant Biology 2022Quote: ... according to manufacturer’s instruction with on-column DNase digestion using 60 μL of DNase mixture (15 μL RQ1 RNase-Free DNase (Promega, M6101), 6 μL RQ1 DNase 10X Reaction Buffer and 19 μL nuclease-free water ...
-
bioRxiv - Molecular Biology 2021Quote: ... and cells with approximately 70-90% confluency in each plate were transfected with required plasmid(s) for each assay using Fugene 6 transfection reagent (Promega, USA) or 1 mg/ml PEI (polyethyleneimine).
-
bioRxiv - Cell Biology 2021Quote: ... and 40 μg of proteins/sample was loaded onto S-trap columns (Protifi) and digested overnight with 1 μg sequencing grade modified trypsin (Promega, V5111) at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids used as DNA template in PCR reactions to generate donor DNAs for gene deletion/disruption strategies were obtained by amplifying blasticidin S deaminase (BSD) and puromycin-N-acetyltransferase (PAC) genes and cloning them individually into pGEM®-T Easy Vector (Promega). The reverse primers to amplify both genes included GTGA as four last nucleotides ...
-
bioRxiv - Cell Biology 2020Quote: To compare Promega’s NanoBiT system β-arrestin2 was inserted at the C-terminal end of LgBiT using Promegas pBiT1.1-N vector (Promega Cat. #N2014) and the doubly palmitolyated fragment of GAP43 was inserted at the N-terminal of SmBiT using the pBiT2.1-C vector.
-
bioRxiv - Cancer Biology 2023Quote: ... The protein solution was spun onto an S-Trap device (Protifi, Farmingdale, NY) and digested by 750 ng trypsin (Promega, Madison, WI) in 100 mM TEAB buffer at 37°C overnight ...
-
bioRxiv - Cancer Biology 2023Quote: ... Digestion was performed in the S-Trap overnight at 37°C using Trypsin/Lys-C Mix Mass Spec Grade (Promega, Walldorf, Germany), followed by elution in 50 mM TEAB ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were processed according to the manufacturer’s recommendations to assess intra-cellular ATP levels as a measure of cellular proliferation and viability using CellTiter-Glo (Promega, Madison, WI). Nonlinear dose-response curves showing the effects of compound concentration on growth inhibition were generated using GraphPad Prism.
-
bioRxiv - Cell Biology 2023Quote: ... The APTES-coated coverslip was assembled into a flow channel and NH2-O4-Halotag ligand (Promega) was immobilized on to the coverslip through glutaraldehyde (Sigma-Aldrich ...
-
bioRxiv - Animal Behavior and Cognition 2020Quote: ... basal luminescence signals for each well (three consecutive data points, 60 s intervals) were recorded with the GloMax® Discover Microplate Reader (Promega, Madison, USA) before odorant application ...
-
bioRxiv - Neuroscience 2022Quote: ... and 30 s extension at 72 °C using the specific primers (Forward: CCACGCAACACACAGTCAAG, Reverse: GCAAGTTACTTTGCAGAGGTC) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 μl ...
-
bioRxiv - Microbiology 2023Quote: An RNA probe was synthesized in vitro from pSPT19 AS1-S using T7 RiboMAX Large Scale RNA Production Systems (Promega, Madison, WI, USA). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... the nLuc activity of each antigen was adjusted to comprise 107 RLU per second (RLU/s) in a volume of 50 µL (NanoGlow, Promega, Madison, Wisconsin, USA).
-
bioRxiv - Developmental Biology 2024Quote: ... R-TAATACGACTCACTATAGGGAGCTGCACGCGACCATCT and transcribed using T7 polymerase (Promega). Categorical scoring was completed blinded.
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Buffer 1X (Gold ST*R 10X Buffer (Promega, Madison, WI)) ...
-
bioRxiv - Neuroscience 2020Quote: ... IgSF8-EGFP and Tenascin-R-EGFP plasmids using Fugene6 (Promega). Twenty-four hours after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... first with 1 µg r-LysC Mass Spec Grade (Promega) for 4 h at 30°C and then samples were diluted below 2 M urea with 100 mM Tris HCl pH 8.5 and 1 µg Sequencing Grade Modified Trypsin was added for the second digestion overnight at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... IgSF8-EGFP or Tenascin-R-EGFP expression constructs using Fugene6 (Promega). Twenty-four hours after transfection ...
-
bioRxiv - Plant Biology 2021Quote: Total RNAs were obtained using Maxwell(R) RSC Plant RNA Kit (Promega). For RNA-Seq ...
-
bioRxiv - Genetics 2020Quote: ... DNA concentration was measured using the QuantiFluor(R)dsDNA System(a) (Promega, USA) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Firefly and Renilla luciferase activities were measured using a luminometer (Promega GloMax(R) Navigator with Dual Injectors) ...
-
bioRxiv - Bioengineering 2021Quote: ... and quantified on a Quantus™ Fluorometer using the QuantiFluor(R) dsDNA System (Promega). The quantification of copies of 16S rDNA was divided by the number of copies naturally present per cell (5 copies·cell-1 according to rrnDB database) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The kinase inhibition assay was done using the Kinase Glo(R) kit from Promega similar to published procedures ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellTiter 96(R) AQueous MTS Reagent Powder were provided by Promega (Madison, Wisconsin, USA). NdCl3 (>99% ...
-
bioRxiv - Neuroscience 2023Quote: ... miR153 Upstream Seq HindIII R: TATATAAAGCTTCTAAGTAGCTGGCAAAGT) of promoter-less pGL4.10 Firefly luciferase construct (Promega), and the NFAT binding site mutated via site directed mutagenesis (miR153 NFAT Mut F ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... stained with Coomassie blue R-250 and in-gel digested using modified trypsin (Promega, sequencing grade) as previously described[70] ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence was measured after 72 h using the Renilla-Glo(R) Luciferase Assay System (Promega E2750) and the GlomAX® Discover Multimode Microplate Reader (Promega) ...
-
bioRxiv - Genomics 2021Quote: ... was extracted from tissue samples using a commercial kit (Wizard R Genomic DNA Purification Kit, Promega) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and both FF-Luc and R-Luc activities were measured using the Dual-luciferase Kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... primers designed for the gene of interest (Table 1) and GoTaq(R) qPCR Master Mix (Promega). Samples were run on an AB 7300 Real Time PCR System (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... and stained with Coomassie blue R-250 before in-gel digestion using modified trypsin (Promega, sequencing grade) as previously described 74 ...
-
bioRxiv - Bioengineering 2021Quote: ... A standard curve was prepared through cloning method using pGEM(R)-T Easy Vector System II (Promega) and JM109 Competent Cells (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... and stained with Coomassie blue R-250 before in-gel digestion using modified trypsin (Promega, sequencing grade) as previously described [88] ...
-
bioRxiv - Microbiology 2022Quote: ... Relative F-Luc activity compared to R-Luc was quantified using a dual luciferase assay (Promega, E1960).
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed with primers Dmd_e22-e24.F / Dmd_e22-e24.R using GoTaq G2 Hot Start Green Master Mix (M7423, Promega) via the following program ...
-
bioRxiv - Biochemistry 2021Quote: ... R-Luc and F-Luc activities were measured 48 h after transfection using the Dual-Luciferase Reporter Assay System (Promega). Renilla luciferase activity was normalized to firefly luciferase.
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Presence of rat cells in myoblast culture/muscle lysate was assessed by PCR for rat dystrophin using primers Rat Dmd i22-i23.F/ Rat Dmd i22-i23.R and GoTaq G2 Hot Start Green Master Mix (M7423, Promega) via the following program ...
-
bioRxiv - Neuroscience 2024Quote: ... were calculated as the ratio of the fluorescence intensities between the initial (F0) and the last (F) 100 seconds by R-CEPIA1er in the Glomax Discover Microplate Reader (Promega). Caffeine-induced Ca2+ transients were also measured with Fura2 AM at room temperature using an ECLIPSE Ti/L100 epifluorescence microscope (Nikon ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Genomics 2022Quote: ... F-luciferase and R-luciferase expression was assayed in a TECAN Spark plate reader using the Dual-Glo® Luciferase Assay System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Lysates were used to measure the activity of F-Luc and R-Luc via the Dual-Luciferase Reporter Assay System (Promega, E1960) in a GloMax 20/20 luminometer (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR analysis of XBP1 splicing was carried out using: XBP1 F 5’-GGAGTTAAGACAGCGCTTGGGGA-3’ and XBP1 R 5’-TGTTCTGGAGGGGTGACAACTGGG-3’ oligonucleotides and GoTaq® Green Master Mix (Promega), using a 58⁰C annealing temperature for 25 cycles ...