Labshake search
Citations for Promega :
51 - 100 of 8279 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: Luciferase reporter assays were carried out using Dual-Luciferase Assay Kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... luciferase assay was performed using the Dual Luciferase Reporter Assay kit (Promega) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Luciferase infectivity assays were performed using the luciferase assay system kit (Promega). Cells were seeded into a Nunc delta surface 96-well cell culture plate (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: This assay was also performed using the luciferase assay system kit (Promega). Cells were seeded into a Nunc delta surface 96-well cell culture plate (ThermoFisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... Luciferase assays were then performed using the NanoLuc luciferase assay kit (Promega), following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... whereupon luciferase assays were performed using the NanoLuc luciferase assay kit (Promega). Luminescence was measured using the Spark multimode microplate reader (TECAN) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Luciferase assay was performed with the Dual-Glo luciferase assay kit (Promega) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... the luciferase assay was performed using a luciferase assay kit from Promega following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: Promoter assays were performed using Dual-Glo Luciferase Assay Systems kit (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Luciferase assays were performed using a one-step luciferase assay kit (Promega), and ATP-based viability with Cell-Titer Glo 2.0 (Promega) ...
-
bioRxiv - Molecular Biology 2024Quote: Luciferase assays were performed with the dual-luciferase reporter assay kit (Promega). Briefly ...
-
bioRxiv - Microbiology 2024Quote: Luciferase assays were performed using the Nano-Glo Luciferase assay kit (Promega). Mouse fecal pellets were collected and weight in 1.7-ml microcentrifuge tubes ...
-
bioRxiv - Biochemistry 2024Quote: Kinase assays were performed using the ADP-Glo Kinase Assay kit (Promega) as follows ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Microbiology 2023Quote: ... Standard curves were generated using purified genomic stocks (HSV-1 bacterial artificial chromosome and human genome Promega #G1471). Absolute copy number of genomic stocks was determined using droplet digital PCR (Biorad QX600) ...
-
bioRxiv - Microbiology 2022Quote: ... The Dual-Luciferase Assay Reporter Kit (Promega) was used to measure both Renilla and firefly luciferase activity according to the manufacturer’s instructions with the modification that 25 μL of reagent were used with 10 μL of sample ...
-
bioRxiv - Molecular Biology 2022Quote: ... The Dual-Luciferase Assay Reporter Kit (Promega) was used to measure both Renilla and firefly luciferase activity according to the manufacturer’s instructions with the modification that 25 µL of reagent were used with 10 µL of sample ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the dual-luciferase assay kit (Promega). Values obtained for RL were normalized to FL values ...
-
bioRxiv - Genomics 2021Quote: ... A Dual-Luciferase Reporter Assay kit (Promega) was used to measure the Rluc and Eluc activities.
-
bioRxiv - Genetics 2021Quote: ... and Pierce 660nm Protein Assay kit (Promega) was used for quantification ...
-
bioRxiv - Cell Biology 2020Quote: Colorimetric LDH release assay kit (Promega G1780) was performed according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: Colorimetric LDH release assay kit (Promega G1780) was performed according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and ADP-Glo™ assay kit (Promega) respectively ...
-
bioRxiv - Cancer Biology 2023Quote: The NAD/NADH-Glo Assay Kit (Promega) was used to measure NAD+ abundance in HCT 116 nuclear extracts ...
-
bioRxiv - Cancer Biology 2024Quote: ... and NADP/NADPH-Glo Assay kit (Promega), respectively ...
-
bioRxiv - Developmental Biology 2023Quote: ... the dual luciferase reporter assay kit (Promega) was used ...
-
Chimeric Antigen Cytotoxic Receptors for In-Vivo Engineering of Tumor-targeting Natural Killer CellsbioRxiv - Immunology 2023Quote: ... CytoTox-Glo™ cytotoxicity assay kit (Promega) was used to measure the number of dead cells in the coculture population ...
-
bioRxiv - Biochemistry 2023Quote: Dual-Luciferase Reporter Assay System kit (Promega) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... CellTox Green Cytotoxicity Assay Kit (Promega, USA); and SYBR Green PCR Master Mix Kit (Baosheng Bioscience (Dalian ...
-
bioRxiv - Microbiology 2022Quote: A GTPase-Glo bioluminescence assay kit (Promega) was used and the manufacturer’s guidelines were adjusted to measure relative intracellular GTP levels by luminescence ...
-
bioRxiv - Biochemistry 2022Quote: Methyltransferase-Glo™ Assay kit from Promega Corporation (Madison ...
-
bioRxiv - Genomics 2022Quote: ... Dual-Luciferase ®1000 Assay kit (Promega) is used to detect firefly luciferase activity.
-
bioRxiv - Cell Biology 2023Quote: ROS-Glo-H2O2 Assay kit (Promega G8820) was used to measure ROS in MEFs culture (medium and cells ...
-
bioRxiv - Cancer Biology 2024Quote: GSH/GSSG-Glo Assay kit (Promega, V6611) was used following manufacturer’s protocol with some modifications ...
-
bioRxiv - Cancer Biology 2021Quote: ... Glucose quantification was conducted using glucose bioluminescent assay kit (Glucose Glo Assay, Promega) as described per manufacturer instruction ...
-
bioRxiv - Molecular Biology 2021Quote: ... and we performed the luciferase assays using a dual-luciferase assay kit (Promega) and quantified them with Monolight 3010 (Becton Dickinson).
-
bioRxiv - Molecular Biology 2021Quote: The luciferase assay was performed with the Dual-Glo Luciferase Assay Kit (Promega) following the protocol in ref ...
-
bioRxiv - Molecular Biology 2020Quote: ... and luciferase assays were performed using the Dual-Luciferase Reporter Assay Kit (Promega), read out on a Turner Biosystems Modulus Microplate luminometer ...
-
bioRxiv - Cancer Biology 2021Quote: ... the luciferase assay was performed using Dual-Luciferase Reporter Assay System kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Luciferase assay was performed using the Dual Luciferase Reporter Assay System kit (Promega). Bioluminescence was measured using CLARIOstar (BMG LABTech).
-
bioRxiv - Biochemistry 2020Quote: GTPase activity assays were carried out using GTPase-Glo assay kit (Promega, V7681).
-
bioRxiv - Genetics 2021Quote: Senescence was measured using 2 assays: 1/ Beta-Glo Assay kit (Promega # E4720), according to the manufacturer’s instructions and utilizing a luciferin-galactoside substrate (6-O-β galactopyranosylluciferin) ...
-
bioRxiv - Plant Biology 2023Quote: ... we used a luciferase-based GTPase assay (GTPase-GloTM Assay Kit by Promega). The assay was carried out as per manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... GTPase assays were performed using the GTPase-Glo Assay Kit (Promega, cat. V7681) basically following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: Kinase assays were conducted using an ADP-Glo™ Kinase Assay Kit (Promega). Reagents were prepared as described in the kit ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by kinase assays run using the ADP-Glo Kinase Assay kit (Promega). After the termination of kinase assay ...
-
bioRxiv - Cancer Biology 2022Quote: ... luciferase assay was conducted using the Luciferase Assay System kit (Promega, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dual luciferase assays were then performed using the Dual Luciferase Assay kit (Promega) as described.(26)
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The kinase assay was conducted using the ADP-Glo Kinase Assay Kit (Promega) with immunoprecipitated CDK5 ...
-
bioRxiv - Microbiology 2024Quote: ... The nano-luciferase assay was performed using Nano-Glo luciferase assay kit (Promega), and luminescence measured by the same machine ...