Labshake search
Citations for Promega :
51 - 100 of 4553 citations for Acetamide N 2 3 dihydro 2 3 hydroxy 2 quinolinyl 1 3 dioxo 1H inden 5 yl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Physiology 2024Quote: ... The locus containing the rdu14 allele was amplified by PCR, using the following primers (Forward: 5’-TGATTCACACTACTTACTTGTCTAG-3’, Reverse: 5’-GATTAAAAGTAGTTATCTCATCCTCAG-3’) and GoTaq polymerase (Promega, ). The genotype of the locus was scored after resolving samples on 2.5% agarose gels as HNF4α+/+ ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Systems Biology 2022Quote: ... and digested with 3 μg LysC (Wako) O/N at 37°C and then with 3 μg of trypsin (Promega) for eight hours at 37°C following FASP procedure (Filter-aided sample preparation 48) ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: 2′3′-cGAMP (0.2 μM) and dsDNA (2 μg/mL) was transfected into cells using FuGENE HD Transfection Reagent (Promega), whereas the transfection reagent without dsDNA or 2′3′-cGAMP was added as the control ...
-
bioRxiv - Neuroscience 2023Quote: ... for 3 hours at RT and then continued overnight with addition of 2 μg of trypsin (Promega, Cat# V5280), at 37 °C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Cell Biology 2024Quote: ... FuGene HD (Promega, E2311, 1:3).
-
bioRxiv - Molecular Biology 2021Quote: ... were inserted using XhoI and NotI sites in 3’ UTR of Renilla gene in the psiCheck-2 dual luciferase reporter vector (Promega). The reporter in the amount of 25 ng and plasmids with different NORAD variants in the amount of 200 ng were introduced per 30,000 cells in 24-well plates ...
-
bioRxiv - Cell Biology 2023Quote: Protein-protein interactions between Mkl1/2 and Foxo1/3/4 or glucocorticoid receptors were also measured using NanoBiT PPI Starter Systems (Promega). 293FT cells were seeded in 96-well white wall microplates and co-transfected with the LgBiT and SmBiT plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... or PCR amplified from the genome (Tom-3’UTR, primers are in Table S1) and cloned into the psiCHECK-2 vector (Promega) linearized with XhoI and NotI restriction enzymes ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Molecular Biology 2024Quote: Luciferase PRE reporters were generated by inserting PRE repeats into the 3’UTR of Renilla luciferase in the psiCheck-2 dual luciferase reporter vector (Promega) (Table S7) ...
-
Aberrant regulation of serine metabolism drives extracellular vesicle release and cancer progressionbioRxiv - Cancer Biology 2024Quote: ... The annealed oligos were ligated into the Xho I and Not I sites in the 3’UTR of the Renilla luciferase gene in the psiCHECK-2 plasmid (C8021, Promega). Each plasmid was transfected individually into HEK 293 cells with miR-891b using DharmaFECT 1 Transfection Reagent (T-2001-03 ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Biochemistry 2024Quote: ... GSK-3 (Promega), CK1 (Promega) ...
-
bioRxiv - Microbiology 2024Quote: ... A 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based viability assay (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega) was performed as previously described (25).
-
bioRxiv - Neuroscience 2024Quote: ... Total RNA from forebrain of P5 WT (n=2) and TgRBFOX1 (n=2) mice was isolated using the Maxwell® 16 RSC simplyRNA Tissue Kit (Promega, AS1340). Total RNA was quantified by Qubit® RNA BR Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... n=2) using the multiplexed ApoTox-Glo assay (Promega). Using 96-well plates ...
-
bioRxiv - Microbiology 2021Quote: ... The V4 region of the 16S rRNA gene was amplified using the universal primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CNN GGG TAT CTA AT-3′) [26] with Taq&Load MasterMix (Promega). PCR reactions ...
-
bioRxiv - Neuroscience 2024Quote: Ensembl predicted regulatory region including the POU domain binding site on Aspm promoter/enhance (sequence from 5’-GAAAAAGTGGGCAGTAACTCGC-3’ to 5’-CAACCTTTCCCTGAGGACGATC-3’) was synthesized by Twist Bioscience and cloned into pGL3-Basic Luciferase Reporter vector (Promega) using the Gibson assembly method ...
-
bioRxiv - Molecular Biology 2024Quote: ... 16.5 μg attB-plasmid library + 3 μg pCAG-NLS-Bxb1 + 2 μg pMAX-GFP + 2150 μL serum-free DMEM + 80 μL FugeneHD (Promega cat# E2311), then incubated at room temperature for 15 min and added dropwise to cells ...
-
bioRxiv - Developmental Biology 2024Quote: ... tRFValCAC sequence was inserted into the multiple-cloning site at the 3’ end of the hRluc gene within the psiCHECK-2 Vector (Promega, cat # C8021). mESCs were transfected using the method described above ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was detected using Caspase-Glo 3/7 (Promega). Annexin V/Propidium Iodide staining was performed using Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... caspase-3/7 levels were examined using Caspase-Glo 3/7 (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... β-arrestin 2 fused at the N-terminus to LgBiT (LgBiT-β-arrestin 2; Promega, plasmid no. CS1603B118) was chosen as it has previously been used successfully with other class B GPCRs ...
-
bioRxiv - Microbiology 2021Quote: ... or 3) Pepsin (Promega). 1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL RNasin (Promega) and 100 µL lysis buffer for a total volume of 300 µL for IP by rotation for 2 hours at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... treated with 3 mM dithiothreitol (DTT) (molecular grade, Cat. 3483-12-3, Promega), and incubated for 30 min at 37°C in 5% CO2 in serum-free RPMI media ...
-
bioRxiv - Physiology 2024Quote: ... HiBiT intensity was measured daily in three biological replicates (3 measurements x 3 wells x 3 replicates / day) in 384-well format using a HiBiT quantification kit (Promega Nano-Glo). 5µl HiBiT reaction mixture (1:100 LgBiT protein and 1:50 HiBiT lytic substrate in HiBiT lytic buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were incubated with 20 μl of 4,5-dimethylthiazol-2-yl-2,5-diphenyltetrazolium bromide (MTT) (AqueousOne, Promega) at 37°C for 1-2 hours for MTS colorimetric cell viability assay ...
-
bioRxiv - Immunology 2024Quote: ... 5-GGATCCACACGGTGCAAAGAGAGACCC-3’ and 5′-TCGGCCTTTCAGACTAATCTTATCAGC-3’ The PCR products were gel purified and cloned into the pGEM-T vector (Promega; Madison, WI, USA). The inserted PCR fragments of individual clones were sequenced by Tsing KE Biological Technology ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Immunology 2020Quote: Caspase-1 and Caspase 3/7 activities were measured using Caspase-Glo® 1 and Caspase-Glo® 3/7 assay (Promega) respectively ...