Labshake search
Citations for Promega :
51 - 100 of 1348 citations for 5 tert Butyl 3 isocyanatoisoxazole since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Molecular Biology 2024Quote: ... The coding sequence of NanoLuc was amplified by PCR using the primers 5-NanoL and 3-NanoL from pNL1.1.CMV plasmid (Promega). The resulting fragment was digested with BamHI and NotI enzymes and cloned into pEGFP-N1 digested with the same enzymes ...
-
bioRxiv - Microbiology 2024Quote: ... Cell viability was assessed after 2 and 5 days (i.e., 3 and 6 days post-treatment) using CellTiter-Glo (Promega) according to the manufacturer’s guidelines ...
-
bioRxiv - Immunology 2024Quote: ... immunoreactive bands were detected using nitroblue tetrazolium–5-bromo-4-chloro-3-indolylphosphate (NBT/BCIP) (Promega, Madison, WI, USA), for human cells and mBMDM ...
-
bioRxiv - Cell Biology 2024Quote: ... Reagents 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT) were from Promega (Madison, WI). The inhibitors of protein synthesis cycloheximide (CXH) ...
-
bioRxiv - Cell Biology 2022Quote: ... After 3 days Caspase-Glo 3/7 (Promega) and CellTiterGlo (Promega ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...
-
bioRxiv - Bioengineering 2020Quote: The therapeutic effect of free taxane (pro)drugs and LNP formulations was determined by the [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96 AQueous One Solution Cell Proliferation Assay (Promega) or the resazurin-based PrestoBlue assay (ThermoFisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated with NBT–BCIP (nitro blue tetrazolium–5-bromo-4-chloro-3-indolyl-phosphate) AP substrate (Promega, Catalog # S3771) for in situ cell staining ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Recombinant baculovirus was produced by transfecting recombinant bacmids (2-3 μg) into Sf9 cells (5 mL, density of 4×105 cells per mL) using FuGENE HD Transfection Reagent (Promega) and Opti-MEM Reduced Serum Media (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: Templates for in vitro transcription of gene-specific 300-500 nt dsRNA and DENV2 EMSA probes were generated by PCR introducing a T7 promoter sequence or a universal tag at both 5’ and 3’ ends using the GoTaq Flexi DNA Polymerase (Promega). If present ...
-
bioRxiv - Microbiology 2021Quote: ... primer TTC CGC AAG TTC ACC TAC C and the reverse (3’ – 5’) primer CGG GCC GGC CAT GCT TTA CG with GoTaq Flexi DNA polymerase (Promega) and the following cycling conditions ...
-
bioRxiv - Systems Biology 2022Quote: ... and 72h in 3-5 wells for each condition (mean values of 3-5 technical replicates are provided for each donor) using a multiwell plate reader Glomax (Promega). Each 2h incubation was performed at a multiplicity of infection (MOI ...
-
bioRxiv - Microbiology 2022Quote: ... was added to a final concentration of 3 mM followed by the addition of 5 µl of T7 Enzyme Mix and 50 U RNasin RNase Inhibitor (Promega). To produce transcripts for mock transfections the GTP concentration was increased to 7.5 mM and cap analogues were not added ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were incubated for 3 days at 35°C with 5% CO2 and cell viability was evaluated using the CellTiter Glo (Promega) post the 3-day incubation ...
-
bioRxiv - Microbiology 2021Quote: ... An MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium]-based viability assay (CellTiter 96 aqueous nonradioactive cell proliferation assay, Promega) was performed as recommended by the manufacturer ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...
-
bioRxiv - Developmental Biology 2024Quote: ... a minimal promoter (5′-AGACACTAGAGGGTATATAATGGAAGCTCGACTTCCAG-3′) and 8x Gli1-binding sites (110) were cloned into the pGL3-Basic vector (Promega), in which Firefly luciferase was replaced with NanoLuc luciferase amplified from the pNLF-N [CMV/Hygro] vector (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: CellTiter 96 AQueous One Solution Cell Proliferation Assay MTS 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) was used according to the manufacturer’s protocol (Promega, Madison, WI) to assess proliferation of cells cultured in 96-well plates.
-
bioRxiv - Cell Biology 2020Quote: ... at 3500 cells/well and cell proliferation over 3-5 day periods was determined by measuring luminescence with CellTiter-Glo® assay kit (G7570, Promega), according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The crRNA (5’-AAUUUCUACUGUUGUAGAUGUGAUAAGUGGAAUGCCAUGUGGG-3’) was synthesized and purified using the T7 RiboMAX™ Express Large Scale RNA Production System (Promega). The following DNA templates were used for the in vitro transcription reaction ...
-
bioRxiv - Zoology 2024Quote: ... The amplicon target was amplified from WNV cDNA using the qPCR primers with the forward primer flanked by T7 sequence (5’-TAATACGACTCACTATAGGGATTCGGGAGGAGACGTGGTA-3’) and transcribed using T7 RiboMAX Express Large Scale RNA Production System kit (Promega, France). RNA was purified by ethanol precipitation ...
-
bioRxiv - Biophysics 2024Quote: ... labeling of TRPV1exCellHalo was completed in the imaging chamber by incubating cells with 3 μM Alexa660 Halo Ligand for 5 minutes (Promega, WI) in HBR followed by 3 minutes of continuous rinsing with HBR perfusion.
-
bioRxiv - Molecular Biology 2024Quote: ... the hdhfr positive selectable marker cassette was PCR amplified from the vector pL-6_eGFP(64) with primers hdhfr 5’ F and hdhfr 3’ R and cloned into pGEM-3Z (Promega, Madison, WI) digested with HincII ...
-
bioRxiv - Cancer Biology 2024Quote: ... DNA and 5% input were analyzed by qPCR using locus specific primers (Table 3) and SYBR Green Master Mix (Promega, A6002). IP DNA values were normalized to input using the following formula ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl 5× Buffer (Promega), 2 μl MgCl2 (25mM) ...
-
bioRxiv - Biochemistry 2022Quote: The 4330bp PCR product amplified from M13mp18 by using primers: oM13-5-27 and oM13-3-24 was inserted into pGEM®-T Easy(PROMEGA #A137A). The resultant plasmid is named as pM13 ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-goat alkaline phosphatase-linked antibody and alkaline phosphatase substrate (5-bromo-4-choloro-3-indolyl 1-phosphate and nitroblue tetrazolium) from Promega (Southampton, UK); a hydroxamate-based MMP inhibitor CT-1746 (N1-[2-(S)-(3,3-dimethylbutanamidyl)]-N4-hydroxy-2-(R)-[3-(4-chlorophenyl)-propyl]-succinamide ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... RBD-R: 5′-TGC CTC GAG CTC AAG TGT CTG TGGATC AC-3′) into pGEM T-easy vector (Promega, Madison, WI, USA). A standard curve was generated by determining the copy numbers derived from serial dilutions of the plasmid (103–109 copies) ...
-
bioRxiv - Cell Biology 2024Quote: ... the membranes were developed with a commercial solution of 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium (NBT) according to the manufacturer (Promega, Madison, WI), in alkaline developing solution ...
-
bioRxiv - Biochemistry 2024Quote: ... GSK-3 (Promega), CK1 (Promega) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell numbers were quantified using a colorimetric 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, Madison, WI) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a reverse transcription using a universal degenerated oligo specific to all 5′ non-coding sequences of BTV-1 segments (BTV/Uni1; 5′ GTTAAAWHDB 3′) and the GoScript Reverse Transcription (RT) System (Promega, Madison, WI, USA). The cDNAs obtained for the segment 7 were then quantified with a real time quantitative PCR (qPCR) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed again in DPBS and stained with 1mg/ml X-gal (5-bromo-4-chloro-3-indolyl-β-galactopyranoside, Promega, Madison, WI, US) in DMF (Dimetil formamide ...
-
bioRxiv - Immunology 2021Quote: ... CDC was measured after incubation for 3 hours at 37 °C 5% CO2 with a luminometer using the CytoTox-Glo Cytotoxicity Assay (Promega; Cat. Nr.: G9291) according to the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2023Quote: ... The amplicons generated from the 5’ and 3’ race PCRs were subjected to purification and subsequent cloning into the pGEM-T easy vector (Promega Corp., WI, USA). The constructed vectors were sequenced (Plasmidsaurus ...
-
bioRxiv - Microbiology 2023Quote: ... and the reaction was revealed with a solution of NBT (nitroblue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl-phosphate) (Promega, Madison, WI, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... the two blots were hybridized O/N at 65 °C to each their radioactively labeled 3’ CF probe (AGO1 3’ CF and CSD2 3’ CF probes labelled with Prime-a-gene labeling kit from Promega). The membranes were washed 3 times in 2xSSC (0.3 M NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase-Glo 3/7 Reagent (Caspase-Glo® 3/7 Assay, Promega) was added to the wells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Caspase 3/7 activity was detected using Caspase-Glo 3/7 (Promega). Annexin V/Propidium Iodide staining was performed using Alexa Fluor 488 Annexin V/Dead Cell Apoptosis Kit (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... caspase-3/7 levels were examined using Caspase-Glo 3/7 (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... or 3) Pepsin (Promega). 1 ...