Labshake search
Citations for Promega :
51 - 100 of 2640 citations for 2 Amino 3 chloro 5 nitro 6 picoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Physiology 2021Quote: ... and 5 μg lentiviral construct with 30 μL Fugene 6 (Promega) the following day ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Molecular Biology 2021Quote: ... 10μM amino acids (Promega), 0.21mM spermidine ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 µl/well of FuGENE 6 Transfection reagent (Promega; E2691) following the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 µl/well of FuGENE 6 Transfection reagent (Promega; E2691) following the manufacture’s protocol ...
-
bioRxiv - Genomics 2020Quote: ... 500 cells were plated in each well of 96-well-plate and each sample had 6 replicates and monitored for 6 days from day 0 to day 5 by CellTiter-Glo 2.0 Assay (Promega, G9242) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... 2-3 minutes after 150mg/kg D-luciferin (ProMega) intraperitoneal administration to allow for circulation ...
-
bioRxiv - Cell Biology 2024Quote: ... Apoptosis was determined as Caspase-3/7 activity immediately after 6-day culture using Caspase-Glo 3/7 Assay (Promega, USA). Luminescence was recorded with the Infinite M200 PRO microplate reader (Tecan ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell numbers were quantified using a colorimetric 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS)-based CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, Madison, WI) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... the chromogenic reaction was performed using the bromochloroindolyl phosphate–nitro blue tetrazolium Color Development Substrate (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Systems Biology 2024Quote: ... The digested samples were combined with 5 μL of 6 x 5 LC-MS/MS Peptide Reference mix (Promega) and stored at-20℃ until analysis.
-
bioRxiv - Developmental Biology 2020Quote: ... with an added 5’-CACC-3’ at 5’-end and 5’-AAAC-3’ at 5’-end of the complementary strand were annealed in 10xT4 ligation buffer (Promega M1801) by continuous cooling from 95°C to 25°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 2-3 µg bacmid DNA was transfected (FuGene HD, Promega) into 2 ml Sf9 cells plated at 0.5x106 cells/ml density in a 6-well plate and left to incubate for 5-7 days 27ºC without shaking ...
-
bioRxiv - Molecular Biology 2024Quote: The cell viability was determined by 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfo-phenyl)-2H-tetrazolium (MTS) assay (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, Promega, Madison, WI, USA). Ramos cells were seeded in 96-well plates at density of 105 cells/well and incubated for 48 h prior to experimental treatments ...
-
bioRxiv - Biochemistry 2024Quote: ... were transfected with 2 µg of bacmid using Fugene 6 transfection reagent (Promega), as described by the manufacturer ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL of a solution that is 1 mM in each of the 20 essential amino acids (Promega, No. L4461); 20 μl of Promega S30 Premix without Amino Acids (No ...
-
bioRxiv - Microbiology 2023Quote: ... were made by replacing the ORF3 region encoding 5–105 amino acids with an in-frame insertion downstream of 4th VP2 codon sequence of UnaG and NanoLuc (Promega) coding regions with their own stop codons ...
-
bioRxiv - Microbiology 2020Quote: Plasmid DNA was combined at a 3:1 ratio of FuGENE® 6 Transfection Reagent (Promega) to DNA and incubated 20 min at RT ...
-
bioRxiv - Molecular Biology 2022Quote: Lentivirus particles were collected from HEK293T cell supernatant 3 days after co-transfection (FuGENE 6, Promega) of lentiviral plasmid constructs (Supplementary Table 2A ...
-
bioRxiv - Neuroscience 2021Quote: ... 67 µM amino acid mixture (Promega), 1x cOmplete protease inhibitors EDTA-free ...
-
bioRxiv - Biochemistry 2021Quote: ... amino acid mix lacking Met (Promega) and 0.1 × volume of an in vitro transcribed mRNA (200-1,000 ng/μL ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.4 mM amino acid mixture (Promega) and 1 u/µl NxGen RNase inhibitor (Lucigen) ...
-
bioRxiv - Biochemistry 2021Quote: ... 20 μM amino acid mix (Promega), and 2mM DL-dithiothreitol ...
-
bioRxiv - Biochemistry 2022Quote: ... 60 μM amino acid mixture (Promega), 50 μM Spermidine ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 μM amino acids mixture (Promega), 1 u/μl RiboLock RNase inhibitor (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... 8 μM amino acids (Promega PRL4461), 255 μM spermidine ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 100 µM amino acid mixture (Promega), 900 ng HiBiT mRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... 1.0 μM 431R2 [5’-CTCTTCACAACAGTCATGTGCG-3’] and 1.0 U GoTaq2 polymerase (Promega). Cycling conditions were 30 s at 98°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... FASP was carried out in two 10 kDa MWCO filters with a 50 mM iodoacetamide alkylation step and proteins were digested in 2M urea with 2% wt/wt Lys-C (Wako) for 6 h and 2% modified trypsin (Promega) for 12 h at 37°C ...
-
bioRxiv - Physiology 2021Quote: ... allowing measurement of 2-deoxyglucose-6-phosphate using the Glucose Uptake-Glo assay (Promega) and a FLUOstar Omega luminescence plate reader.
-
bioRxiv - Microbiology 2021Quote: ... The V4 region of the 16S rRNA gene was amplified using the universal primers 515F (5′-GTG CCA GCM GCC GCG GTA A-3′) and 806R (5′-GGA CTA CNN GGG TAT CTA AT-3′) [26] with Taq&Load MasterMix (Promega). PCR reactions ...
-
bioRxiv - Neuroscience 2024Quote: Ensembl predicted regulatory region including the POU domain binding site on Aspm promoter/enhance (sequence from 5’-GAAAAAGTGGGCAGTAACTCGC-3’ to 5’-CAACCTTTCCCTGAGGACGATC-3’) was synthesized by Twist Bioscience and cloned into pGL3-Basic Luciferase Reporter vector (Promega) using the Gibson assembly method ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were incubated for 6 h at 37°C with 3 μg Sequencing Grade Modified Trypsin (Promega). Digestion was terminated via addition of 20 μL trifluoroacetic acid (TFA) ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Cell Biology 2020Quote: ... in 2× SSC supplemented with 3% (vol/vol) RNasin Ribonuclease inhibitor (Promega), 6% (vol/vol ...
-
bioRxiv - Biochemistry 2021Quote: ... 25 μM amino acids minus methionine (Promega), 1 μM Ipom-F ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.02 mM of each amino acid (Promega), 33% RRL (Promega ...
-
bioRxiv - Biophysics 2020Quote: ... 10 μM amino acids mixture (Promega, L4461), 1 U μL−1 murine RNase inhibitor (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 µM amino acid mix (complete, Promega), 4 U RNaseIn plus Ribonuclease Inhibitor (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... 25 μM amino acids minus methionine (Promega), 6.5% (v/v ...
-
bioRxiv - Biochemistry 2024Quote: ... supplemented with Complete Amino Acid Mixture (Promega), potassium acetate (Promega) ...
-
bioRxiv - Immunology 2022Quote: ... DDX60 (Fw 5’- AAGGTGTTCCTTGATGATCTCC-3’ Rv : 5’ -TGACAATGGGAGTTGATATTCC-3’) as analyzed by semiquantitative PCR using the SYBR Green assay GoTaq® qPCR Master Mix (Promega) with standardized primers (Metabion) ...