Labshake search
Citations for Promega :
51 - 100 of 4459 citations for 2 1 ethylpentyl 1 3 dioxan 5 yl laurate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... elution buffer I (2 M Urea, 50 mM Tris pH 7.5, 1 mM DTT and 5 ng/µl Trypsin (Promega, #V5111)) were added and samples were incubated for 1 h at RT ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
bioRxiv - Physiology 2024Quote: ... The locus containing the rdu14 allele was amplified by PCR, using the following primers (Forward: 5’-TGATTCACACTACTTACTTGTCTAG-3’, Reverse: 5’-GATTAAAAGTAGTTATCTCATCCTCAG-3’) and GoTaq polymerase (Promega, ). The genotype of the locus was scored after resolving samples on 2.5% agarose gels as HNF4α+/+ ...
-
bioRxiv - Microbiology 2021Quote: ... in a 3:1 ratio of FuGENE®HD (Promega) transfection reagent to DNA ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... t-ERK1/2 (Promega V114A, 1/1000 dilution), p-AKT (Cell Signaling Technology ...
-
bioRxiv - Biophysics 2022Quote: ... 2 μg trypsin (protein:enzyme ratio 50:1; Promega) were added and proteins were digested at 37 °C for 18 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1:2 DNA:FuGENE® HD transfection reagent (Promega) ratio and 2 μg of specific plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... followed by a reverse transcription using a universal degenerated oligo specific to all 5′ non-coding sequences of BTV-1 segments (BTV/Uni1; 5′ GTTAAAWHDB 3′) and the GoScript Reverse Transcription (RT) System (Promega, Madison, WI, USA). The cDNAs obtained for the segment 7 were then quantified with a real time quantitative PCR (qPCR) ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL of HaloTag TMR ligand (Promega, 5 mM) was added to 100 µL of JetABC (2.5 µM d-o-p ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μL refolding reaction was diluted 1:5 into luciferase assay system mix (Promega), and luminescence was measured on the GloMax-20/20 Luminometer (Promega) ...
-
bioRxiv - Synthetic Biology 2022Quote: To measure luciferase activity on plaque containing LB-agar plates, 5 μl of the diluted (1:50, in PBS) NanoLuc® luciferase substrate 2-furyl methyl-deoxy-coelenterazine (Furimazine; Promega) were dropped onto the respective plaques ...
-
bioRxiv - Biophysics 2020Quote: ... 1 mM EGTA, 5% glycerol) and freshly supplemented reagents (1 mM DTT, 1 mM ATP, 1 mM PMSF, protease inhibitor mix (Promega) and 1% Tween 20) ...
-
bioRxiv - Immunology 2021Quote: ... then each well was diluted 1:3 with TE buffer (Promega). A 2.7 μL aliquot from each sample was mixed with 2.5 μL of SsoFast EvaGreen Supermix with Low Rox (Bio-Rad ...
-
bioRxiv - Biochemistry 2024Quote: ... using random primers and oligo-dT primers (3:1 mol) (Promega). The obtained cDNA was stored at −20 °C until further use.
-
bioRxiv - Systems Biology 2024Quote: ... 1 µg plasmid was combined with 3 µl FuGENE (Promega, E2311) in OptiMEM medium for each ml of culture medium ...
-
bioRxiv - Developmental Biology 2020Quote: ... primers were used to amplify the PCR product (fwd 5’-GCTGTFATAGGGTGGAGGTG-3’, rev 5’GCTATCAACGCCATTGTGAA-3’) using 1X GoTaq Green (Promega, Madison, WI) with a final primer concentration of 0.2uM ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Cell Biology 2023Quote: ... 1% Triton X-100, 2 mM DTT, 100 μg ml-1 cycloheximide [Sigma], 20 U ml-1 RNase inhibitor [Promega] ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Bound proteins were eluted with elution buffer 1 (50 mM Tris-HCl pH 7.5, 2 M urea, 5 ng/µL sequencing grade modified trypsin (Promega, Madison, WI, USA), 1 mM DTT ...
-
bioRxiv - Plant Biology 2022Quote: ... Approximately 2-5 ng of purified genomic DNA was spiked with 1% (w/w) of unmethylated cl857 Sam7 Lambda DNA (Promega, Madison, WI) and sheared to about 400bp using Covaris M220 (Covaris Inc. ...
-
bioRxiv - Genomics 2023Quote: ... 0.25 μl of 1% Digitonin in DMSO (Promega (2%), Cat ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM DTT and 5 μg/μl of trypsin (Promega)) for 3 min at 30°C ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 units/1 L RQ1 RNase-free DNase (Promega). Lysate was clarified via centrifugation at 17,800 x g for 30 minutes at 4°C.
-
bioRxiv - Molecular Biology 2021Quote: ... transfected with 1 µg DNA and 3 µl FuGENE HD (Promega, E2311) in 150 µl Opti-MEM media according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... and pVSV-G (4:3:1 ratio) using calcium phosphate transfection (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... and anti-activated Caspase 3 (rabbit, Promega, catalog #G7481, 1:250, RRID:AB_430875), and appropriate secondary antibodies ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 μL of 1:100 diluted NanoBRET Nano-Glo substrate (Promega N1571) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 μL of BrightGlo reagent solution (Promega, diluted 1:3 in water) was added to each well after 24 h of compound treatment ...
-
bioRxiv - Plant Biology 2022Quote: ... followed by 3 μL sequencing-grade trypsin solution (1 μg/μL, Promega), and the sample was incubated for 12 h at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... Aliquots #1 and #2 were then treated with 1 mg/mL trypsin (Promega, Madison, WI, USA) and incubated at 37 °C for 1 h followed by the addition of 1.5 mg/mL trypsin inhibitor (Worthington Biochemical Corp ...
-
bioRxiv - Immunology 2024Quote: ... 2-3 minutes after 150mg/kg D-luciferin (ProMega) intraperitoneal administration to allow for circulation ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 mM CaCl 2 and 10 ng/μL trypsin (Promega). Trypsin digestion was performed at 37 °C with rotation overnight and the beads were washed three times with PBS and distilled water again ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Molecular Biology 2020Quote: ... and proteins were sequentially digested with LysC (1:50, w/w; FUJIFILM Wako) for 3 h at 37 °C and trypsin (50:1, w/w; Promega) overnight at 37 °C ...