Labshake search
Citations for Promega :
901 - 950 of 985 citations for SARS CoV 2 Spike Glycoprotein S1 RBD Fc Tag CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Microbiology 2023Quote: The assay was adapted from 15 where Hyp1-Nluc schizonts at 1% hematocrit and 1-2% parasitaemia were lysed in 1x NanoGlo buffer (Promega, USA) within a 96-well flat-bottom plate and parasite lysates were added to compounds and incubated for 10 minutes at 37°C ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 µL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 µL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Neuroscience 2023Quote: ... equal amount of RNA (2 μg) from each sample was subjected to cDNA synthesis using reverse transcriptase Kit (Promega Corporation, USA) following standard procedures ...
-
bioRxiv - Biophysics 2023Quote: ... transfection was carried out by adding 2 μg of freshly prepared bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311), following the instructions provided by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of furimazine substrate was added to the reaction well from a working reagent stock of a 2:100 NanoDLR Stop & Glo Substrate to Buffer ratio (Promega #N1610). A total well volume of approximately 112.5 μL was incubated at room temperature for 2 minutes prior to measuring luminescence and OD600 readings on an EnVision plate reader (PerkinElmer).
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:5000 in 2% BSA in TBST) for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... the 200k pellets were digested for 2 h at 37°C with 0.4 µg of Trypsin/Lys-C (Promega CAT#: V5071) and then overnight by adding 0.4 µg of Trypsin/Lys-C ...
-
bioRxiv - Genetics 2023Quote: ... After adding 2 µg MS grade trypsin in the intraspecific hybrids (Pierce Biotechnology, Waltham, MA) and polyploids (Promega Corporation, Madison, WI) to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 µg of bacmid DNA were used to transfect Sf21 cells for baculovirus generation using FuGENE® transfection reagent (Promega). The protein was expressed in Lonza Insect-EXPRESS™ medium for 72-96 h ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Levels of reporter mRNAs in eggs were measured 6 hrs post-injection by RT-qPCR using the GoTaq 2-Step RT-qPCR system as per manufacturer’s instructions (Promega, Madison, WI) with random primers for reverse transcription and oligos listed in Table 1 for the qPCR step.
-
bioRxiv - Neuroscience 2024Quote: ... Peptide digestion was initiated by adding 25 µL of 50 mM ammonium bicarbonate buffer (pH 8) containing 2 µg trypsin (Sequencing Grade Modified Trypsin, Promega, # V5117) directly on top of the column and incubating overnight at 37 °C ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 μL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 μL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Microbiology 2023Quote: ... for 2 hours at 72 hours and lysed at 98 hours using 25 μl Dual-Glo® Luciferase Assay System (Promega). Luminescence was measured ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were then washed 3x with TBS-T and incubated for 2 hours at room temperature with either anti-rabbit (1:5000, Promega W4011) or anti-mouse HRP (1:5000 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... the treatment was removed from the wells and the cells were incubated with 100 μl of EGM™-2 complete medium with 20 mM HEPES and 20 μl of MTS (Promega, CellTiter 96® AQueous One Solution Reagent ...
-
bioRxiv - Immunology 2024Quote: ... mice were humanely killed by xylazine/ ketamine overdose and lungs inflated with 1 ml of 2% low melting temperature agarose (Promega, US) at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... qRT-PCR was executed in a total of 20μl reaction volume which includes 2 X Mix SYBR green I (10μl; Promega Corporation, Madison, WI, USA), primer (0.25μl ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was monitored every 30 seconds for 2 min using a luminometer (GloMax® 20/20n Luminometer, Promega Italia, Milan, Italy) for the luciferin/luciferase chemiluminescent method ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of pCS2-HA-NFATc3 was incubated for 2 h at 30°C in 50 μl of the TNT® SP6 coupled wheat germ extract system (Promega, #L5030), according to the instructions of the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... cells were transfected according to manufacturer instruction with a transfection mix containing a ratio of 1 µg of plasmid for 2 µl FuGene HD transfection reagent (Promega, REF E2311) diluted in DMEM without FCS ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’int-F and 24nt-6stp-R primers and 2) 3’KI: 24nt-6stp-F and 3’int-R using the GoTaq DNA polymerase mix (Promega, Madison, WI) and 200 nM of each primer ...
-
bioRxiv - Molecular Biology 2021Quote: ... protein ratio of 1:50 w/w for 2 hours at 37°C and further digested with 30 µL 50 mM TEAB containing trypsin (Sequencing Grade Modified, Promega, Madison, WI) at a trypsin ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3’UTR sequences were cloned downstream from the renilla luciferase gene using the XhoI and NotI sites in the siCHECK-2 vector (Promega, Madison, WI). This vector also contains a firefly luciferase gene driven by an independent protomer ...
-
bioRxiv - Neuroscience 2019Quote: ... Gaussia luciferase activity was measured in the dark 0.1 sec after injection of 100 μl/well of 40 mM coelenterazine, substrate (NanoLight, Pinetop, AZ) using a 2 second integration on a Veritas Microplate Luminometer (Promega, Madison, WI). The cells were subsequently assayed for red Firefly activity using the ONE-GloTM Luciferase Assay System kit (Promega ...
-
bioRxiv - Microbiology 2019Quote: ... 2 μg of purified RNA for each sample was used to synthesize cDNA using M-MLV Reverse Transcriptase (Promega, Madison, WI, USA) at 42°C for 1 h ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were co-transfected with pCAGGS-FLPe and col1a1-EF1α-GFP at a 1:2 ratio using FuGENE HD Transfection Reagent (Promega, Cat. # E2311), and selected in 50μg/ml hygromycin starting 48 hours post-transfection ...
-
bioRxiv - Plant Biology 2021Quote: ... The PCR product was run on 2% agarose gel and the expected bands were eluted using Wizard® SV Gel and PCR cleanup kit (Promega, USA),cloned in pGEM-T easy vector (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: Melan-ink4a melanocytes were seeded on glass coverslips in 24-well plates at 3×104 cells/well and the day after were transfected with 1 μg of cDNA plasmid (Table S2) mixed with 2 μl of FuGENE6 (Promega, Madison, Wisconsin) in 500 μl Opti-MEM ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted to 2 M urea with 50 mM HEPES (pH 8.5) and proteolyzed with trypsin (Promega, 1:50 w/w) at room temperature overnight ...
-
bioRxiv - Microbiology 2022Quote: ... the virus-induced cytopathogenic effect was measured colorimetrically by the formazan-based 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) cell viability assay (CellTiter 96 AQueous One Solution Cell Proliferation Assay from Promega, Madison, WI), and the antiviral activity was expressed as the 50% effective concentration (EC50) ...
-
bioRxiv - Microbiology 2022Quote: ... The light production was then monitored at 20-minute intervals at 37 °C for 2 hours using the Glomax 20/20 Luminometer (Promega, Madison, WI). A final measurement was also taken after the samples had been allowed to incubate overnight at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... Filters were transferred to 2 mL microfuge tubes for further processing using the Maxwell® RSC PureFood GMO and Authentication Kit (Promega Corporation) with a modified version of the kit protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... (49) as a negative control (2 μg of DNA per well of 6 well plate) with FuGene transfection reagent (Promega, Madison, WI) according to manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: ... for gram-negative bacteria and cDNA library preparation was performed using the GoTaq® 2-Step RT-qPCR System (A6010, Promega, USA). The RT-PCR was done using the Applied Biosystems™ 7500 Real-Time PCR System and primers shown in the supplementary data table S2 (35-38) ...
-
bioRxiv - Pathology 2020Quote: ... RNA (2 µg) was reverse transcribed through the GoScript™ Reverse Transcription System performed with Oligo(dT)15 (Promega, Madison, Wisconsin, EUA), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... For transfection 0.5 or 2 µg of plasmid DNA in 25 or 200 µL serum-free medium were mixed with 1 or 4 µL of FuGENE HD transfection reagent (DNA to reagent ratio of 1:2, Promega, Mannheim, Germany) and incubated for 10 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... OXA-111-NcoI F or OXA-71-NcoI F and OXA-66-XhoI R primers (Table 2) and TA cloned into the vector pGEM-T Easy (Promega, United Kingdom). The inserts were confirmed by sequencing with the universal T7 Promoter primer ...
-
bioRxiv - Genomics 2019Quote: ... All PCR products were checked on 2% agarose gels and then cleaned with the Wizard SV Gel and PCR Clean-up System from Promega (Madison, Wisconsin) and sent off for Sanger-sequencing along with the amplification primers to Molecular Cloning Laboratories (San Francisco ...
-
bioRxiv - Cancer Biology 2019Quote: ... The cell viability was assessed by the viability assays 3-(4,5-dimetiltiazol-2-il)-5-(3-carboximetoxifenil)-2-(4-sulfofenil)-2H-tetrazolio (MTS) using the Cell-Titer 96c AQueous Non-Radioactive Cell Proliferation Assay kit (Promega, Madison, USA) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Luminescence was read after 2 minutes shaking on an orbital shaker and 10 min incubation at RT using the GloMax instrument (Promega, Madison, USA).
-
bioRxiv - Cell Biology 2020Quote: ... Columns were washed with 90% methanol/100 mM TEAB 10 times prior to on-column digestion with 1 ug Trypsin/Lys-C in 50 mM TEAB (47° C, 2 hours; Cat. #V5073, Promega, Madison, WI). The resulting peptides were eluted with sequential washes of 50 mM TEAB ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized via reverse-transcription of 2-5 μg of RNA using M-MLV Reverse Transcriptase (200 U, Promega, Wisconsin, USA), random primers (10 ng/μl ...
-
bioRxiv - Biophysics 2020Quote: ... First-strand cDNA was synthesized from 2 μg of total RNA with oligo (dT)15 primers and GoScript™ Reverse Transcriptase (Promega, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The PCR products were extracted from a 2% agarose gel and purified using AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, USA) and quantified by QuantiFluor™-ST (Promega, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were incubated for an additional 2 – 6 days and cell growth was quantified using CellTiter-Glo® 2.0 Reagent (Promega, Cat. #924C). For immunoblot analysis ...
-
bioRxiv - Biophysics 2022Quote: pHalo-PPARγ2 expresses human PPARγ isoform 2 fused to HaloTag in the N-terminus under a CMVd1 promoter (Promega ORF clone #FHC08305). PPARγ2 mutants were generated by nucleotide substitution using the QuikChange II XL Site Directed Mutagenesis Kit (Stratagene ...
-
bioRxiv - Immunology 2022Quote: ... cells were washed 2 times with phosphate-buffered saline (PBS) and lysed with Luciferase Cell Culture Lysis 5x reagent (Promega, Madison, WI). Using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Plant Biology 2022Quote: ... Approximately 2-5 ng of purified genomic DNA was spiked with 1% (w/w) of unmethylated cl857 Sam7 Lambda DNA (Promega, Madison, WI) and sheared to about 400bp using Covaris M220 (Covaris Inc. ...
-
bioRxiv - Molecular Biology 2023Quote: ... diluted with 4 volumes of 20 mM Tris-HCl pH 8 2 mM CaCl2 prior to overnight digestion with 100 ng sequencing grade trypsin (Promega, Cat# V5111) at room temperature ...