Labshake search
Citations for Promega :
901 - 950 of 1911 citations for AKT1 2 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were adjusted to 3 mM EDTA and digested with 0.5 μg Trypsin/LysC mix (Promega #V5073) for 1h at 37°C ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were first transfected with 3′UTR luciferase constructs (10 ng) using FuGENE HD transfection reagent (Promega) for 4 hours then transfected with Dharmacon miR-199a-5p mimic (50 nM ...
-
bioRxiv - Cell Biology 2020Quote: ... Radiolabelled protein was translated from mRNA using the rabbit reticulocyte lysate system (Promega) and 35S-labelled methionine ...
-
bioRxiv - Molecular Biology 2019Quote: ... In vitro translation reactions were performed in nuclease-treated Rabbit Reticulocyte Lysate (Promega) as described by the manufacturer ...
-
bioRxiv - Microbiology 2019Quote: ... Secondary antibodies (anti-mouse or anti-rabbit) conjugated to horseradish peroxidase (HRP, Promega) were diluted 1:25,000 in 3% (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... Immunodetection was carried out using rabbit polyclonal anti-Halo antibody (Promega; 1:1000), mouse anti-HA antibody (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... followed by a horseradish peroxidase (HRP)-conjugated anti-rabbit IgG secondary antibody (Promega). Chemiluminescence signals were detected using the GE ImageQuant LAS4000 camera (GE Healthcare Life Sciences).
-
bioRxiv - Developmental Biology 2021Quote: The antibodies used were: Rabbit anti-pJNK pTPpY (1:500, Promega, Cat#V93B), Rat anti-Ci(1:1,000 ...
-
bioRxiv - Immunology 2022Quote: ... Anti-Rabbit (W4018) and Anti-Mouse (W4028) secondaries antibodies were bought from Promega.
-
bioRxiv - Cell Biology 2022Quote: ... from Invitrogen and HRP-conjugated anti-mouse (W4021) and anti-rabbit (W4011) antibodies from Promega.
-
bioRxiv - Molecular Biology 2023Quote: In vitro translation was performed using a rabbit reticulocyte lysate system (Promega, L4960). 1.5 μL of purified eIF2A protein or BSA was added to 10 μL rabbit reticulocyte lysate reaction mix ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-rabbit IgG (H+L) HRP-conjugated (1:10000; Cat. no. W4011, Promega), anti-mouse IgG (H+L ...
-
bioRxiv - Biochemistry 2023Quote: In vitro translation assays were performed using nuclease-treated rabbit reticulocyte lysate (Promega). Reactions were in 10 µl containing 2 µl RRL ...
-
bioRxiv - Systems Biology 2023Quote: ... Horseradish peroxidase-conjugated secondary antibodies were purchased from Promega (anti-rabbit IgG, W4011). Membranes were stripped with 0.2 M NaOH as needed ...
-
bioRxiv - Plant Biology 2023Quote: ... incubated with the secondary antibody rabbit anti chicken IgY HRP [(Promega Corporation, G1351) 1:10000] for 2 h and again washed three times ...
-
bioRxiv - Molecular Biology 2024Quote: In vitro translation was performed using a rabbit reticulocyte lysate system (Promega, L4960). Capped and polyadenylated reporter mRNAs containing the first 135 nucleotides of NPR coding sequences (human ...
-
bioRxiv - Molecular Biology 2024Quote: Rluc mRNA and Fluc mRNA were incubated with rabbit reticulocyte lysate (RRL, Promega) to generate the mRNA-ribosome complex ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Microbiology 2020Quote: ... A DENV-1 3’UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were transfected with the Piggybac plasmid plus transposase at a 3:1 ratio using Fugene HD (Promega) and selected with G418 (300 µg/mL ...
-
bioRxiv - Biochemistry 2022Quote: ... Elution was conducted in 3 beads volume of proteasome buffer containing 1 μL of TEV protease (Promega, PRV6101) for 1 hr at 37°C.
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Systems Biology 2024Quote: ... followed by a 3:1 dilution with 100mM ammonium bicarbonate and addition of 2µg sequence-grade trypsin (Promega). Samples were digested at room temperature overnight and acidified with formic acid (final concentration 1%) ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Microbiology 2020Quote: ... PCR reactions were performed using a 2× GoTaq PCR master mix (Promega), biotin-labeled M13F and biotin-labeled M13R primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of expressing plasmids were transfected using Fugene HD (Promega, #E2311). After 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2mM Mg(OAc)2 and 10μM of the amino acid mixture (Promega). Reactions were incubated with 5μM of the indicated nsp1 protein for 30 min on ice ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA (2 μg) was treated with RQ1 DNase (Promega, Madison, Wisconsin) and reverse-transcribed with the SuperScript VILO cDNA Synthesis Kit (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... A transfection solution containing 2 μl oligo-fectamine (Promega, Madison, WI, USA), 40 μl MEMI ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and were incubated with Glosensor reagent (Promega, 7.5 μL, 2% final concentration) for 90 min at room temperature ...
-
bioRxiv - Bioengineering 2021Quote: ... All hADAR1/2 fragments were cloned into the pCI-Neo vector (Promega) to generate the pCI-ADAR vectors ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM DTT] containing 0.5 mM of freshly added rATP (Promega, E6011) in 10-μl reactions ...
-
bioRxiv - Cancer Biology 2021Quote: ... the samples were digested overnight with 2 μg sequencing grade trypsin (Promega) and trypsin inactivated by adding TFA to a final concentration of 1% v/v ...
-
bioRxiv - Molecular Biology 2021Quote: 50 nl of reverse transcription mix (2 mM (each) dNTP mix (Promega) and 0.8 Units Superscript III (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... On odd days 30 μl of Cell TiterGlo 2 (Promega cat # G924A) was added to the remaining 40 μl culture and incubated 10 min ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mL of Halo Magne bead slurry (cat. #G7287, Promega, Madison, WI) were washed with MilliQ water and 3 CV of modified CSF-XB ...
-
bioRxiv - Biochemistry 2021Quote: ... the samples were digested by addition of 2 % (w/w) trypsin (Promega) over night at 37°C ...
-
bioRxiv - Genetics 2019Quote: ... 1 mM CaCl2 with 2 ug trypsin (Promega, Madison, WI, product V5111). Digest was stopped with formic acid ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The Nano-Glo Luciferase Assay Substrate furimazine (2 µl ml-1, Promega) was added and the luminescence was measured on a luminometer (Mithras LB 940 Berthold Technologies plate reader ...