Labshake search
Citations for Promega :
851 - 900 of 1551 citations for Tick Borne Encephalitis Virus Envelope Protein Human Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... Proteins were digested overnight by adding 1 μg of trypsin (Promega, Madison, Wisconsin) in 100 μL ABC at 37 °C overnight ...
-
bioRxiv - Systems Biology 2021Quote: ... Proteins were digested overnight by adding 1 μg of trypsin (Promega, Madison, Wisconsin) in 100 μL ABC at 37 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... Protein digestion was performed using Trypsin Gold (MS grade; Promega, cat. no. V5280). Processed peptides were acidified by formic acid (final concentration 5% ...
-
bioRxiv - Plant Biology 2020Quote: ... 100µg protein were digested in solution with RapiGestTM with 1 µg Trypsin (Promega) over night ...
-
bioRxiv - Systems Biology 2020Quote: ... Protein precipitation was performed by methanol-chloroform and proteolysis by trypsin/RapiGest (Promega Gold Grade ...
-
bioRxiv - Plant Biology 2019Quote: ... 100 μg of total protein was digested by Trypsin Gold (Promega, Madison, WI) with 1:100 w/w ratio at 37 °C for 18 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were digested with 0.4 μg of sequencing grade modified trypsin (Promega, #V5111) in 40 μl Hepes/NaOH ...
-
bioRxiv - Genomics 2021Quote: ... Proteins were digested by adding 0.2 µg of trypsin (Promega, Madison, WI, USA) per sample followed by incubation in 25 mM NH4HCO3 at 37°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Proteins were digested with Lys-C (Wako Chemicals) and trypsin (Trypsin Gold, Promega).
-
bioRxiv - Plant Biology 2021Quote: ... Proteins were digested with trypsin (Sequencing Grade Modified Trypsin, Promega, Madison, WI, USA) at a 1:50 (trypsin:protein ...
-
bioRxiv - Plant Biology 2021Quote: ... The protein expression reaction was mixed with HaloTag-ligand conjugated magnetic beads (Promega) to pull down the HaloTag-fused TF ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: ... The proteins enriched by neutravidin beads were digested with MS-grade trypsin (Promega). The on-beads digested peptides were collected and desalted by the in-house prepared reversed phase C18 Stage-tip ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were subjected to digestion using 20 µg sequencing grade Glu-C (Promega) in 1 M urea at 37°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... HiBiT-fused proteins were visualized using the Nano-Glo HiBiT Blotting System (Promega). As an internal control of HiBiT proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... the bead-bound protein was incubated with 6.7 μM HaloTag-TMR ligand (Promega) for 15 minutes at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... and IgG captured and eluted from Magne Protein A beads (Promega, Madison, WI) as previously described (27 ...
-
Mitochondrial dysfunction rapidly modulates the abundance and thermal stability of cellular proteinsbioRxiv - Biochemistry 2022Quote: ... Proteins were digested with 0.4 μg of sequencing grade modified trypsin (Promega, #V5111) in 40 μl Hepes/NaOH ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Cell Biology 2022Quote: Proteins were digested from gels with 0.02 μg/μL modified porcine trypsin (Promega) after reduction with dithioerythritol and iodoacetamide ...
-
bioRxiv - Biophysics 2022Quote: ... Cleaved MSP protein was subsequently biotinylated using EZ-Link Maleimide-PEG11-Biotin (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... An equal number of proteins were digested with trypsin (Promega, Madison, WI, USA) at a ratio of 1:50 (w:w ...
-
bioRxiv - Neuroscience 2022Quote: ... the proteins were digested with 1.5 µg of Trypsin/Lys-C mix (Promega) for 16 h at 37°C (800 rpm) ...
-
bioRxiv - Cell Biology 2022Quote: The protein in the gel lanes were digested with 0.1 µg trypsin (Promega) in 20 µl 25 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2023Quote: ... the proteins were digested with 1 µg of trypsin/Lys-C mix (Promega) for 16 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Subsequent protein digestion was performed using Endoproteinase LysC and Trypsin (Ref.: V5071, Promega), diluted 1:25 (enzyme to protein ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were digested using a trypsin and lys-C mix (Promega, Madison, USA) at a ratio of 100:1 ...
-
bioRxiv - Systems Biology 2023Quote: ... Halo-fusion proteins were purified with Magne® HaloTag® Beads (Promega, USA) and then incubated with 50 ng ampDAP library ...
-
bioRxiv - Biophysics 2023Quote: Labeling reactions: Proteins with HaloTag were labeled with JF646-HaloTag ligand (Promega # GA1120) by incubating the proteins with a tenfold excess of dye on ice for 0.5-1 h in the presence of 1 mM ATP ...
-
bioRxiv - Systems Biology 2023Quote: ... The washed protein was then digested with trypsin (sequencing grade modified trypsin; Promega) in a mixture of 100 mM ammonium bicarbonate (pH 8 ...
-
bioRxiv - Biochemistry 2023Quote: ... In vitro protein synthesis by the coupled transcription and translation (TnT) system (Promega) was carried out in the presence of 35S methionine in either wheat germ or rabbit reticulocyte lysates ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Biochemistry 2023Quote: ... RBD proteins in culture media were measured in Nano-Glo buffer (Promega N1110) supplemented with Nanoluciferase substrate and 11S protein according to the manual ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples were then digested overnight at 37°C with Trypsin Gold (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and digestion of purified crosslinked protein with sequencing grade modified porcine trypsin (Promega), tryptic peptides were separated by reverse phase XSelect CSH C18 2.5 um resin (Waters ...
-
bioRxiv - Microbiology 2023Quote: ... HiBiT-tagged proteins were detected using the Nano-Glo HiBiT blotting system (Promega) according to the manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were digested with Lys-C (Wako) and sequencing-grade trypsin (Promega, V5117) (1 μg of each in 20 μL of 50 mM TEAB ...
-
bioRxiv - Microbiology 2024Quote: ... Cleared protein extracts were incubated with 200 μl of MagneHis solution (Promega, USA) overnight ...
-
bioRxiv - Immunology 2024Quote: ... 5 mg purified RIPR protein fragment was incubated with TEV protease (Sigma/Promega) at a 1:10 v/v ratio overnight at 4 °C on a rolling mixer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were then in-gel proteolyzed using Sequencing grade modified porcine trypsin (Promega), and peptides were eluted (80% acetonitrile ...
-
bioRxiv - Microbiology 2023Quote: ... were digested with a modified MS grade trypsin (Promega; 1:5 enzyme/protein) overnight at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were digested with 0.75 µg trypsin (Sequencing Grade Modified Trypsin, V5111, Promega) overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...