Labshake search
Citations for Promega :
851 - 900 of 1461 citations for Recombinant Human SDC1 Protein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Pyroptotic cell death was measured by assessing LDH-release in the cell culture supernatant of human and murine macrophages using a CytoTox 96 Non-radioactive Cytotoxic Assay (Promega) following the manufacturer’s recommended procedures.
-
bioRxiv - Cancer Biology 2023Quote: All human-derived cell lines were validated by short tandem repeat (STR) profiling using PowerPlex® 16 HS System (Promega) once a month ...
-
bioRxiv - Cell Biology 2024Quote: ... The DNA fragments were PCR-amplified with primer pairs containing a XhoI and BamHI site from human genomic DNA (Promega) and subcloned into the pCLL-NoPromoter-FLuc-CMV-RLuc-dsRed2 vector ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Plant Biology 2019Quote: ... In the next step proteins were digested overnight using 100 ng/µl trypsin (Promega) at 37°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins bound to streptavidin-sepharose matrix were digested with trypsin (Promega, Madison, WI, USA) during 16 h or eluted for western blot analysis ...
-
bioRxiv - Genetics 2021Quote: The in vitro protein translations were performed using the TNT-assay (L4610) from Promega according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: Tryptic digestion of proteins was carried out using porcine trypsin (Promega, GmbH, Mannheim, Germany). Trypsin solution prepared in 100 mM Ambic and 1 mM CaCl2 at a 0.01 μg/μl concentration and 100 μl added onto each sample for a final concentration of ~1.2 μg trypsin per sample containing 30 μg of total protein (trypsin to sample ration 1:25) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The proteins were digested in 1 M urea with modified trypsin (Promega, Madison, WI) at a 1:50 enzyme-to-substrate ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested with Lys-C (Wako Chemicals) overnight and trypsin (Trypsin Gold, Promega) for 6 hours.
-
bioRxiv - Molecular Biology 2020Quote: ... Protein pellets were resuspended in 8 M urea buffer combined with protease inhibitor (Promega) and purified using the chloroform-methanol precipitation method (Wessel & Flügge ...
-
bioRxiv - Biophysics 2022Quote: ... The purified Kif5B protein was incubated with 10 µM HaloTag PEG-Biotin ligand (Promega) for 30 min on ice to produce a final construct of Kif5B homodimer with two C-terminal biotin tags ...
-
bioRxiv - Cancer Biology 2019Quote: Proteins were digested with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA) by using filter-aided sample preparation methods[13] ...
-
bioRxiv - Immunology 2020Quote: ... IgG was purified from culture supernatant using Magne Protein A beads (Promega, Madison, WI) and the elution buffer exchanged with PBS using Amicon Ultra centrifugal filters (Millipore-Sigma ...
-
bioRxiv - Immunology 2021Quote: Proteins were in-gel digested with sequencing grade modified trypsin (Promega GmbH, Walldorf, Germany) similar to the procedure described by Pandey et al ...
-
bioRxiv - Neuroscience 2020Quote: ... samples containing 100 μg total protein were mixed with 100 μl Luciferase Substrate (Promega). The kinetics of the luminescence was recorded for 10 min using a TriStar2 S LB 942 Plate Reader (Berthold Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... The proteins were digested overnight at 37°C with Sequencing Grade Modified Trypsin (Promega) and the reaction was stopped by acidification ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were digested overnight at 37 °C by addition of 3 μg trypsin (Promega) and 2 μg LysC (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: Proteins were synthesized using TNT® SP6 Quick Coupled Transcription/Translation system (Promega L2080) using the standard reaction mix (rabbit reticulocyte lysate plus amino acids ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested for 18 h at 37°C with 0.5 μg trypsin (Promega). After digestion ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins were digested for 18 hours at 37 °C with trypsin/LysC mix (Promega) at a protein-to-protease ratio of 25:1 ...
-
bioRxiv - Systems Biology 2020Quote: ... Proteins were digested for 18-24 hours on beads with sequencing grade trypsin (Promega) in 50 mM HEPES buffer at 1:50 trypsin to protein ratio for frozen tumors and 2 μg trypsin per 10 μm section of FFPE ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were digested at 37 °C overnight with trypsin (Promega; 1:10, enzyme/substrate) in the presence of 10% acetonitrile ...
-
bioRxiv - Cell Biology 2020Quote: ... The protein extract was digested with trypsin (Catalog No. V5280, Promega, Madison, WI, USA) (trypsin ...
-
bioRxiv - Biophysics 2021Quote: Some protein kinase assays were performed using the ADP-Glo™ assay kit (Promega), which measures the generation of ADP in a kinase reaction ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Proteins were digested for 18 h at 37°C with 0.5 μg trypsin (Promega). After digestion ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were digested for 18 h at 37°C with 0.5 μg trypsin (Promega). After digestion ...
-
bioRxiv - Microbiology 2020Quote: ... Half the lysate was used to quantify luciferase protein (Promega Luciferase Assay System #E1501) using a Spectramax L luminometer with reagent injectors in technical triplicate ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins (200 µg) were digested overnight with Lys-C (Wako Chemicals) and trypsin (Promega) using the filter-aided sample preparation protocol29 ...
-
bioRxiv - Neuroscience 2020Quote: ... Bound proteins were digested on-resin with trypsin (Trypsin Gold, Mass spectrometry grade, Promega) at 37 °C overnight in 25 mM ammonium bicarbonate ...
-
bioRxiv - Molecular Biology 2019Quote: ... The translated protein was analyzed using a Transcend Non-Radioactive Translation Detection System (Promega).
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... alongside 5 µl of broad molecular weight protein marker (Broad Range Molecular Marker, Promega), was loaded onto the gel and run at 200 volts for 55 minutes using a Mini-PROTEAN Electrophoresis System (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... Proteins were in-gel digested using 0.6 µg of modified sequencing grade trypsin (Promega) in 50 mM ammonium bicarbonate overnight at 37°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... [35S]-labeled Zc3h10 protein was produced by using TNT coupled transcription/translation kit (Promega). 20 ug of GST fusion proteins were incubated for 2 hrs at 4°C with in vitro translated Zc3h10 and glutathione sepharose beads ...
-
bioRxiv - Cell Biology 2019Quote: ... proteins were further digested overnight at 37°C with sequencing-grade modified trypsin (Promega) at a protein-to-enzyme ratio of 50:1 ...
-
bioRxiv - Plant Biology 2020Quote: ... and used for protein digestion with sequencing-grade modified trypsin (Promega, Madison, WI, USA). Resulting peptides were purified using Sep-Pak Vac tC18 100 mg cartridge (Waters ...
-
bioRxiv - Immunology 2020Quote: ... The proteins were digested with Trypsin Gold overnight at 37°C (Promega, Madison, WI). The resulting peptides were de-salted using C18 SPE cartridges (Waters ...
-
bioRxiv - Neuroscience 2019Quote: ... The proteins were digested overnight at 37°C with Sequencing Grade Modified Trypsin (Promega) and the reaction was stopped by acidification ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Proteins were digested with two separate and sequential aliquots of sequencing grade trypsin (Promega) of 1 μg ...
-
bioRxiv - Physiology 2020Quote: The protein solution samples were hydrolyzed into peptide segments by trypsin (V9012, Promega (Beijing) Biotech Co. ...
-
bioRxiv - Biochemistry 2021Quote: ... proteins were digested overnight at 37 °C using trypsin (1:50, w/w, Promega). Peptides were extracted in ACN and formic acid and combined extracts were freeze-dried ...
-
bioRxiv - Developmental Biology 2021Quote: ... 50 μl of 0.5M TEAB and trypsin (Promega, enzyme: protein ratio of 1:50) were added to the membrane ...
-
bioRxiv - Microbiology 2021Quote: ... proteins were digested ingel using modified trypsin (sequencing grade, Promega, Charbonnières les Bains/France) as previously described (50).
-
bioRxiv - Microbiology 2021Quote: ... and digested with sequencing grade trypsin (Promega, 1:50 trypsin- to-protein [wt/wt]) (Yang et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Protein digestion was accomplished by overnight incubation at 37 °C with trypsin (V5111, Promega) at a 1:20 enzyme to protein mass ratio ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was digested at 37 °C overnight by adding sequencing-grade trypsin (Promega) at a 24:1 substrate-to-enzyme ratio ...
-
bioRxiv - Biochemistry 2022Quote: ... ⑤Resuspended the denatured proteins with 25 mmol/L NH4HCO3 and digested with trypsin (Promega, Fitchburg ...
-
bioRxiv - Plant Biology 2022Quote: ... PsiYAB11 protein was expressed using the TNT SP6 Coupled Wheat Germ Extract System (Promega). The protein-bound beads were incubated with 50 ng of adaptor-ligated gDNA fragments on a rotator for 1 h at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: In-gel protein digestion of every spot was performed using sequencing-grade trypsin (Promega) as described elsewhere (26) ...
-
bioRxiv - Neuroscience 2023Quote: ... proteins were digested overnight at 37°C using MS-grade trypsin (Promega, Cat# V5280). The next morning ...