Labshake search
Citations for Promega :
851 - 900 of 1320 citations for Rat ERICH6 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... or mutant β2AR INTAL and a plasmid encoding a cyclic-permuted luciferase reporter construct (pGloSensor-20F, Promega) and luminescence values were measured ...
-
bioRxiv - Developmental Biology 2023Quote: ... eGFP coding sequence was replaced by HaloTag (pFN23K-Halo plasmid, given by St Jonhston lab, Promega G2861), amplified using primers CACCTAGGATGGCAGAAATCGGTACTGGCTTTCCATTCGACC and CTACGCGTTGCCGGAAATCTCGAGCGTGG for Su(H)::Halo ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...
-
bioRxiv - Genetics 2022Quote: ... The digested plasmid was purified using the Wizard SV Gel and PCR Clean-Up System (Promega A9281). The zebrafish exorh promoter region was amplified from pCK029 (this manuscript ...
-
bioRxiv - Cell Biology 2023Quote: ... and then they were transfected with the expression plasmid DNAs by using FuGENE 6 (Promega, Madison, WI).
-
bioRxiv - Immunology 2023Quote: ... 1 ng pEF1α-Renilla and 120 ng plasmid of interest complexed with 0.8 µl FuGENE HD (Promega) diluted to 10 µl total volume in OptiMEM ...
-
bioRxiv - Microbiology 2023Quote: ... plasmids were prepped from the cell using a Wizard® Plus SV Minipreps DNA Purification kit (Promega). The entire plasmid sequence was obtained using the company Plasmidsaurus ...
-
bioRxiv - Cell Biology 2023Quote: ... The inserts and plasmid backbones were purified with Promega Wizard SV gel and PCR Cleanup System (Promega). Purified inserts and backbones were mixed in a molar 3:1 ratio ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids were transfected into HepG2-NTCP cells using either polyethylenimine (PEI) or FuGENE HD Transfection Reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.5 µg (HEK293A, HEK293T, HEK293AΔARRB1/B2) or 2 µg (HEK293AΔGs, HEKS293AΔGi) Glo-22F cAMP plasmid DNA (Promega) and 2 µg MOCK DNA (HEK293A ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Developmental Biology 2023Quote: ... 16/32-cell embryos were co-injected with 5 pg of pRL-TK:renilla luciferase plasmid (Promega E2241) + 80 pg of the pGL4.23 luc2/miniP HumanPDX1 enhancer:firefly luciferase plasmid (wt or 6RFX motif mutant ...
-
bioRxiv - Microbiology 2024Quote: ... 20 µg of the plasmid was co-transfected with 2.5µg of pGL4.75 Renilla luciferase control vector (Promega) into DT40 AIDR/puro UNG-/- cells ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and the lentiviral packaging plasmids pMD2.G (170ng) and pCMV-dR8.91(1.33μg) using 10μl of Fugene HD (Promega #E2312) according to manufacturer protocols ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Cells expressing the transporters were additionally transfected with a plasmid coding for NanoLuc (N1411, Promega, Madison, WI) and selected with 40 μg/ml hygromycin B (InvivoGen ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids containing rsbU or rsbT/rsbUY28I were subjected to PCR mutagenesis using GoTaq DNA polymerase mix (Promega) supplemented with 2mM additional MgCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Plasmids were sequenced to confirm the integrity of the construct and purified with a PureYield kit (Promega) for injection ...
-
bioRxiv - Biochemistry 2024Quote: ... plasmids were performed with the transfection reagent FuGENE® HD (Promega, Ref: E2311, Promega GmbH, Walldorf, Germany) at a 2:1 FuGENE® HD:DNA ratio according to the manufacturer protocol ...
-
bioRxiv - Genetics 2023Quote: ... which were introduced by amplification of the plasmid with the indicated mutation primers followed by DpnI (Promega) digestion ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell signalling) or rabbit anti-TgTOM40 (1:2000, (van Dooren et al., 2016)) antibodies coupled to secondary horseradish peroxidase (HRP)(Promega for mouse and rabbit, Abcam for rat) conjugated antibodies (1:10,000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... These plasmids were then transfected in H1299 shPKM2 cells using FuGENE HD transfection reagent (Promega, Madison, WI, USA) and cultured in DMEM for 48 h (Fig ...
-
bioRxiv - Microbiology 2019Quote: Plasmid pGEMt was used for the ligation of purified PCR products according to manufacturer’s protocol (Promega A1360, USA). The reaction mixture includes 5µl of buffer 2X ...
-
bioRxiv - Molecular Biology 2021Quote: Cells were transfected with CRISPR–Cas9 and donor plasmids (Table 2) using FuGENE HD Transfection Reagent (Promega, #E2311) in a 6-well plate following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 2.0 ug DNA of expression plasmids were mixed 150 μL Opti-MEM and transfected using FuGENE HD (Promega) at a DNA to FuGENE HD ratio of (1:3) ...
-
bioRxiv - Cell Biology 2022Quote: For plasmid transfections cells were grown to 40-50% confluency and transfections were performed using FuGene6 (Promega, E2692) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... The total amount of DNA in the transfections was kept constant by supplementing with empty pCI plasmid (Promega). Plasmids encodings HCN1-4 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were transfected with a control Flag or HA-GSK-3βWT human plasmid using Fugene 6 (Promega #E2693) in a 2:1 ratio and incubated for 3 hours in a CO2 incubator ...
-
bioRxiv - Biochemistry 2019Quote: ... HEK cells at a density of 3 million were transfected with 3.5μg each of CCR2 and the luciferase-based cAMP biosensor (pGloSensorTM-22F plasmid; Promega) plasmids ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmids used for transfection were purified with Wizard Plus SV Minipreps DNA Purification System (Promega, Madison, WI, USA) or NucleoBond Xtra Midi (Macherey-Nagel ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were then transfected with 1500 ng pcDNA-FLAG-HA-sscGAS plasmid complexed with FuGene 6 reagent (Promega) according to manufacturer’s instructions or treated with FuGene 6 alone as a negative control ...
-
bioRxiv - Immunology 2021Quote: ... The RARα open reading frame (NP_000955) was sub- cloned from the original plasmid (pFN21AE1591, Promega KK, Tokyo, Japan) into the pFC14K plasmid (Promega) ...
-
bioRxiv - Neuroscience 2020Quote: ... pCAG-DCC:TDTOMATO and pCAG-DCCkanga:TDTOMATO plasmids (1 µg) were transfected into the plated U251 cells using FuGENE 6 (Promega) in Opti-MEM (Gibco ...
-
bioRxiv - Bioengineering 2020Quote: ... Wizard Mini-Preps Plasmid DNA purification and SV Gel Clean-up kits were purchased from Promega (MyBio, Ireland). The O2-sensitive phosphorescent probe Pt-Glc was synthesized as described before [82] ...
-
bioRxiv - Neuroscience 2020Quote: Transfected neuronal cultures with the NF-κB reporter Firefly Luciferase plasmid (Cat. N° E1980, Promega, Madison, WI, USA), were stimulated with NMDA/glycine for 60 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transiently transfected with 0.1 ug of an individual plasmid with Fugene HD reagent (Promega, Madison, WI). 48 hours later ...
-
bioRxiv - Systems Biology 2020Quote: Renilla control plasmid (3630 bp) was derived from another commercial vector pGL4.70 with the hRluc renilla gene (Promega) by insertion of a moderate-strength P transposase (pTran ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were plated in 24-well plates and transfected with 0.25 μg plasmid DNA and 1.25 μL FuGENE (Promega). Primary neuronal culture was prepared as described previously (40) ...
-
bioRxiv - Microbiology 2019Quote: ... 48 hours later cells were transfected with a plasmid encoding HA of the FPV mutant using Fugene (Promega). 24 hours later cells were labelled for 2 hr with 200 µCi/ml [3H]-palmitic acid (9,10-3H(N) ...
-
bioRxiv - Microbiology 2020Quote: ... The KAN PCR amplicon with compatible ends was ligated into the plasmid backbone using T4 DNA ligase (Promega). The resultant pEXP5/Kan vector was linearized using XbaI and Butters gp31FLAG was ligated into the plasmid for transformation into chemically competent BL21 cells ...
-
bioRxiv - Microbiology 2021Quote: Plasmid pAMD375 was constructed using oligonucleotides JW10881 and JW10882 to amplify the NanoLuc luciferase gene from pNL1.1 (Promega). The resulting DNA fragment was cloned into pAMD001 (40 ...
-
bioRxiv - Molecular Biology 2022Quote: RepEx-PCR-generated ~100x CAG repeats were inserted into a dual-luciferase reporter plasmid modified from pmirGLO (Promega) between firefly luciferase (FLuc ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with a pHR’SIN:CSW transgene expression vector and the viral packaging plasmids pCMVdR8.91 and pMD2.G using FuGENE HD (Promega, #E2312). Primary T cells were thawed the same day and after 24 h in culture ...
-
bioRxiv - Microbiology 2022Quote: ... virus was removed and cells were transfected with 2 µg of plasmid DNA pUCSP-A24Rcd using FuGeneHD (Promega) following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 8.0) with 2-5µg plasmids pre-digested by XcmI and 50 µg of herring sperm carrier DNA (Promega), then 700 µL of yeast transformation buffer (40% (w/v ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMD2.G and the lentiviral gRNA plasmid at a 3:1:5 mass ratio using FuGENE HD (Promega) in Opti-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Luciferase activity was measured 24 hours after plasmids transduction by lysing the cells in the Passive Buffer (Promega) and combining equal volumes of cell lysates with the Bright-Glo™ Reagent (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... HepG2 cells were co-transfected with the firefly reporter vectors and the Renilla luciferase plasmid pRL-TK (Promega) as an internal control ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid DNA was isolated from each clone using Wizard® Plus SV Miniprep kit (Promega, Madison, WI, USA) and a total of 72 individual clones were sequenced with pJET1.2-F and pJET1.2-R primers at Eurofins Genomics Germany GmbH.
-
bioRxiv - Molecular Biology 2020Quote: ... plasmid pGL4.32 containing a firefly luciferase cassette under NF-κB response elements was obtained from Promega (Cat# E8491). For overexpression of ubiquitin ...
-
bioRxiv - Microbiology 2020Quote: ... duplicate wells were transfected with 1 µg HDM_Spike_RBD_B7-1 plasmids and 1 µg of Transfection Carrier DNA (Promega, E4881) using BioT reagent (Bioland Sci ...