Labshake search
Citations for Promega :
851 - 900 of 1661 citations for Mouse NXPE4 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... incubated with mouse anti–βIII-tubulin (1:2000; Promega, G7121) overnight at 4ºC followed by incubation with secondary antibody (donkey anti-mouse Alexa-Fluor 488 ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans and mouse cDNA (PolyATtract® mRNA Isolation Systems, Promega and ProtoScript® First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2019Quote: ... mouse mAB anti-β-Galactosidase antibody (Z378A, 1:500, Promega), pAb rabbit anti-active JNK (V7931 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Secondary antibodies where HRP conjugated (Promega, Rabbit W401B, Mouse W402B) for ECL detection using Pierce ECL2 solution (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2019Quote: ... and HaloTag (mouse monoclonal, Promega no. G9211; 1:1000 dilution). Membranes were incubated for one hour at room temperature with IRDye secondary antibodies (Goat anti-Mouse 680RD ...
-
bioRxiv - Cell Biology 2019Quote: ... HRP-conjugated secondary antibodies against mouse and rabbit IgG (Promega).
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies were detected using HRP-conjugated mouse secondary antibody (Promega). UAP56/DDX39B [1:2000] (custom generated51 ...
-
bioRxiv - Microbiology 2022Quote: ... Anti-mouse IgG conjugated with horseradish peroxidase (HRP; Promega, Japan) diluted 1:3000 in Canget signal solution 2 (Toyobo ...
-
bioRxiv - Neuroscience 2022Quote: ... or mouse anti-β-galactosidase (Z378A from Promega, 1/1000). Secondary antibodies (anti-rabbit IgG-Alexa Fluor 633 and anti-mouse IgG-Alexa Fluor 488 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and mouse anti-HiBiT (1.0 µg/ml; Promega clone 30E5), overnight at 4 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... Horseradish peroxidase-conjugated antibodies (anti-rabbit and anti-mouse; Promega) were applied followed by chemiluminescent ECL detection (Amersham ...
-
bioRxiv - Cell Biology 2023Quote: ... the following antibodies were used: anti-Halo (mouse, G9211; Promega), anti-α-tubulin (rabbit ...
-
bioRxiv - Developmental Biology 2023Quote: ... Zeev Paroush) and mouse anti-LacZ (1:1000, Promega z3781). Detection was performed using mainly goat anti-rabbit IgG H&L (DyLight® 488 ...
-
bioRxiv - Cell Biology 2023Quote: Mouse livers were homogenized in Luciferase Culture Lysis Reagent (Promega). Lysates were clarified by centrifugation at 13,000 × g for 20 min at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... or SL1-deleted SARS-CoV-2 5’ UTR luciferase reporter plasmid using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Luciferase Assay System (Promega) ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were transfected with pAV-Tornado-RhoBAST plasmid (~200 ng/well) using FuGeneHD transfection reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were transfected with reporter plasmid and various Nsp1 constructs using FuGENE Transfection Reagent (Promega). Luciferase assays were performed using the Dual Luciferase Assay System (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... The calibration curves were generated using serial dilutions of pGEM-T Easy plasmid DNA (Promega, USA) carrying a single copy of the target gene fragment (qp1F/qp1R) ...
-
bioRxiv - Genomics 2020Quote: ... 300ng of plasmid DNA for each biological replicate was transfected into HepG2 cells using FuGENE (Promega) in triplicate ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were transfected with plasmids encoding fluorescently tagged proteins using FuGENE® HD Transfection Reagent (Promega), following manufacturer’s protocol and assayed 1-3 days after transfection ...
-
bioRxiv - Immunology 2019Quote: ... CHO-K1 cells (European Collection of Cell Cultures) were stably transfected with plasmids using FuGene (Promega), stable cell lines were created ...
-
bioRxiv - Molecular Biology 2020Quote: ... and the plasmid DNA was purified using the Wizard Plus SV Minipreps DNA Purification System (Promega) or QIAGEN Plasmid Midi kits.
-
bioRxiv - Microbiology 2019Quote: ... The hbdH gene was excised from a sequence verified plasmid using restriction endonucleases (Promega, Madison, WI). The expression vector pET45b (Novagen ...
-
bioRxiv - Genomics 2019Quote: The PCR products were excised from agarose gels and ligated into pGEM-T vector plasmids (Promega) with T4 DNA ligase (Promega) ...
-
bioRxiv - Physiology 2019Quote: ... Plasmid DNA (6 µg) was mixed (1 : 3 ratio) with transfection reagent (Fugene 6; Promega, UK) in reduced serum media (OptiMEM ...
-
bioRxiv - Genomics 2019Quote: ... 2 μg of each of these reporter plasmids along with 100 ng of pRL-TK (Promega), a Renilla luciferase expression plasmid to control for transfection efficiency ...
-
bioRxiv - Cell Biology 2019Quote: ... the pGL4.34 vector plasmid containing the CArG box (SRF response element) was purchased from Promega (Cat.E1350). An empty vector was generated by removing the SRF response element ...
-
bioRxiv - Cell Biology 2019Quote: ... These reporter vectors were transfected into HepG2 cells along with a β-galactosidase control plasmid (Promega) to normalize transfection efficiency ...
-
bioRxiv - Immunology 2021Quote: pCIneo Precursor miR-146a (pmiR-146a) and HA-HuR plasmids were transfected using Fugene HD (Promega) for RAW264.7 cells as described previously (Goswami et.al ...
-
bioRxiv - Biochemistry 2020Quote: ... subjected for mini-prep plasmid purification by Wizard® Plus Minipreps DNA Purification System (Promega, USA), and used as the template in subsequent PCR amplification of the given library ...
-
bioRxiv - Synthetic Biology 2021Quote: ... was used to combine the two split EPG sections with N-Terminal HaloTag Plasmid PHTN (Promega) such that the N-terminal HaloTag sequence is preceded by the signal sequence at its 5’ end and succeeded by the rest of the EPG sequence at the 3’ end ...
-
bioRxiv - Microbiology 2021Quote: ... The reporter plasmid pAP1-Luc and promoterless-RLuc (pGL4.70) were purchased from Promega (Madison, WI, USA).
-
bioRxiv - Microbiology 2021Quote: All virus stocks were produced by plasmid transfection of HEK 293T cells with Fugene 6 (Promega). Supernatants were harvested at 48h and 72h ...
-
bioRxiv - Cell Biology 2021Quote: ... The digested plasmid was purified using the Wizard SV Gel and PCR Clean-up system (Promega). A guide sequence (TATTCGAGGCCATCGTGTACCGG ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with Galectin-3-GFP plasmid (0.5 µg) using FuGene HD (Promega, Madison, WI) with a ratio of 3:1 for 24 h at 37 °C in 5% CO2 ...
-
bioRxiv - Biophysics 2022Quote: ... Cells were transiently transfected with 50 ng each of the appropriate plasmids using FuGENE HD (Promega) at a FuGENE DNA ratio of 3:1 ...
-
bioRxiv - Cell Biology 2022Quote: ... The HaloTag-SmBiT fragment was PCR amplified from the commercially available plasmid (Promega, Cat no: N202A) and also subcloned into pcDNA3.1 ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were co-transfected with the BeGC1 plasmid and the pGloSensor-42F cGMP vector (Promega) using Lipofectamine 2000 (Thermo Fischer Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... The linearized plasmids were used as templates for in vitro transcription with T3 RNA polymerase (Promega) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2020Quote: Plasmid DNA was combined at a 3:1 ratio of FuGENE® 6 Transfection Reagent (Promega) to DNA and incubated 20 min at RT ...
-
bioRxiv - Cancer Biology 2021Quote: ... BT-549 and HCC38 cells were transfected with both plasmids simultaneously (2 μg) using FuGene (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... plasmids at the designated concentrations were added to OptiMEM media with FuGENE HD Transfection Reagent (Promega) at a 3:1 FuGENE:DNA ratio ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NUMB1-4 (from V.O.R.) expression plasmids was performed using FuGENE HD transfection reagent (Promega, E2311) according to the manufacturer’s protocol and selected with Geneticin (Gibco ...
-
bioRxiv - Plant Biology 2019Quote: ... we used a control plasmid provided in the TnT® Quick Coupled Transcription/Translation System (Promega). The plasmid was linearized using the restriction enzyme SacI and purified using the DNA Clean and Concentrator Kit (Zymo Research) ...
-
bioRxiv - Immunology 2020Quote: ... All luciferase constructs were co-transfected with pRL-TK Renilla luciferase plasmid (Promega, Madison, WI, USA) to normalize transfection efficiency variation between samples ...
-
bioRxiv - Cell Biology 2020Quote: ... 1000 ng of donor and gRNA plasmids in 1:1 ratio was used using ViaFect (Promega) transfection reagent as per manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2021Quote: ... The pTM plasmids were transfected into H7-T7-IZ cells using ViaFect™ Transfection Reagent (Promega) following the manufacturer’s recommendations.
-
bioRxiv - Molecular Biology 2020Quote: Aag2 and U4.4 cells were transfected with the appropriate plasmids using Fugene HD Transfection Reagent (Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Plasmids encoding the cAMP sensor (pGloSensor-22F) and the following luciferase reporters were purchased from Promega: CRE-luc2 ...
-
bioRxiv - Plant Biology 2020Quote: ... cDNA of GRXS17 (At4g04950) were inserted into the pGEM-T Easy plasmid (Promega, Madison, WI, USA). Different point mutations of cysteines to serines in GRXS17 were generated using QuikChange II Directed Mutagenesis Kit (Agilent ...