Labshake search
Citations for Promega :
851 - 900 of 4012 citations for 7 Oxabicyclo 4.1.0 hepta 2 4 diene 1 3 4 trifluoro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... 2 µL RQ1 DNase (Promega) was added to remove templates and incubated at 37°C for 20 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... psiCHECK-2™ (Promega, C8021) luciferase plasmids and primers used can be found in Supplemental Table S6B and Supplemental Table S7C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were subjected to digestion of Lys-C (Wako Chemicals) (1:50) for 2 h at RT and then to trypsin (Promega) (1:50 ...
-
bioRxiv - Microbiology 2019Quote: Protein digestion - for samples processed with reagent 1 and 2 as well as for supernatants (proteomes) MS grade trypsin (Promega) was used at 1:1000 w/w protease:protein ...
-
bioRxiv - Biochemistry 2021Quote: Pulldowns with cellular extracts were carried out as described for GFP-immunoprecipitations using 1-2 μg of GST-fused proteins bound to glutathione magnetic beads (Promega). For immunoprecipitations of recombinant proteins ...
-
bioRxiv - Genomics 2021Quote: ... Cell number was normalized before seeding by measuring ATP levels in a 1:2 dilution series of digested organoids with CellTiter-Glo (Promega). The number of cells matching 10,000 photons (Berthold Technologies ...
-
bioRxiv - Biophysics 2020Quote: ... for 2 hours at 37° C and subsequently diluting to 1 M urea with 50 mM NH4HCO3 and finally adding 2% (w/w) trypsin (Promega) for 14 hours at 37° C ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were resuspended at 2 x 106 cell mL-1 in complete media and HaloTag substrate conjugated to TMR (Promega) was added at a final concentration of 5 μM ...
-
bioRxiv - Microbiology 2021Quote: ... spxB gene region containing the ORF (amplified from R6 genome using primer set 1-2) was cloned into pGEM-T Easy vector (Promega). spxB ORF was disrupted by cloning a kanamycin resistance cassette (amplified from pIBD38 ...
-
bioRxiv - Genomics 2019Quote: ... 2 μl US bait primer and 2 μl Illumina universal primer 10 μM (0,4 μM final concentration each primer) and 1 μl GoTaq (Promega, M5005) with the following program ...
-
bioRxiv - Developmental Biology 2021Quote: ... Samples were washed twice with UA buffer and twice with 50mM ammonium bicarbonate prior to digest of the immobilized proteins on the filter for 2 h at RT using 1 mg Lys-C (Wako Chemicals) and for 16 h at 37C using 2 mg trypsin (Promega). Tryptic peptides were collected by centrifugation (10 min at 14,000 g) ...
-
bioRxiv - Genomics 2020Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Pathology 2021Quote: RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the GoTaq 1-step qRt-PCR kit (Promega) using 3.8µL of extracted RNA and 6.2µL of RT-qPCR mix that contains 250nM of each primer and 75nM of probe ...
-
bioRxiv - Cell Biology 2020Quote: ... The reduced and alkylated protein lysates were diluted using 50 mM Tris-Cl to obtain a final concentration of 2 M urea in solution followed by overnight digestion with trypsin (1:1000)(Promega). Peptides were then desalted using c-18 Sep-Pack columns (Waters) ...
-
bioRxiv - Genetics 2020Quote: ... 1-2 μL of cDNA was used for 25 μL PCR reactions using the GoTaq Hot Start Master Mix (Promega). Cycling parameters consisted of an initial denaturation of 95°C for 2 min. ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were diluted 8x in 50 mM ammonium bicarbonate to reduce the urea concentration to 1 M and protein digestion was performed overnight at 37 C by addition of 2 µg of trypsin (Promega) per sample.
-
bioRxiv - Neuroscience 2023Quote: ... samples were diluted with 50 mM NH4HCO3 to a final concentration of less than 2 M urea and were further digested overnight with 1:25 (w/w) trypsin (Promega) at room temperature ...
-
bioRxiv - Microbiology 2023Quote: RT-qPCRs were performed with MLV SU or 2-LTR primers (Table 1) using a Power SYBR green PCR kit (Promega) and the QuantStudio 5 real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... to a final urea concentration ˂ 2 M and then digested with modified trypsin (1:50 w/w) (Sequencing Grade, Promega) at 37°C for 3 h ...
-
bioRxiv - Neuroscience 2023Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours followed by another overnight digestion with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Neuroscience 2023Quote: ... lysyl endopeptidase (Wako) at 25°C for 2 hours and further digested overnight with 1:50 (w/w) trypsin (Promega) at 25°C ...
-
bioRxiv - Biophysics 2019Quote: ... we mixed 3 ng/μL of lambda DNA (D1501, Promega) and 5 nM of condensin in an Eppendorf tube for a 10 min incubation to induce condensin-DNA interaction ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell viability was measured 3 days later using CellTiterGlo (Promega).
-
bioRxiv - Immunology 2020Quote: ... the protein suspension was digested with 3 μg trypsin (Promega) in 40 μl 25 mM NH4HCO3 overnight at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... (3) we used ProNex Size-Selection DNA purification System (Promega) for purification of PCR product ...
-
bioRxiv - Cancer Biology 2019Quote: ... cleaved caspase 3 was visualized with antibody (Promega Cat # G7481)) labeled with Qdot 655 Streptavidin conjugate (Thermo Cat# Q10121MP) ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... followed by 3 h at 37°C using trypsin (Promega). All proteolytic digests were acidified to pH 2 by addition of 10% formic acid and directly analyzed by LC-ESI-MS/MS ...
-
Dual and Opposing Roles for the Kinesin-2 Motor, KIF17, in Hedgehog-dependent Cerebellar DevelopmentbioRxiv - Developmental Biology 2022Quote: ... we utilized BetaFluor β-gal assay kit (Promega 70979-3) to distinguish between Kif17+/- and Kif17-/- littermates at postnatal day 8 ...
-
bioRxiv - Microbiology 2023Quote: ... the permeabilization protocol used a 3 minute 0,02% digitonin (Promega) exposure ...
-
bioRxiv - Cancer Biology 2023Quote: ... after which 3 μL of CellTiter-Glo reagent (Promega, G7572) was added to each well ...
-
bioRxiv - Immunology 2023Quote: ... Tissues were embedded in 3% low melting point agar (Promega). Formalin embedding ...
-
bioRxiv - Biochemistry 2022Quote: 2’-Deoxythymidine-5’-triphosphate (dTTP) and 2’-deoxyguanosine-5’-triphosphate (dGTP) were obtained from Promega. 2-14C labeled 2’-deoxythymidine-5’-triphosphate (2-14C-dTTP ...
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Plant Biology 2019Quote: ... An aliquot containing 4 μg RNA was treated for 45 min with 2 μl of DNase RQ1 (1 μg/μl) at 37 °C (Promega, UK), and purified using an RNAeasy spin column (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Cell Biology 2019Quote: ... cat # 129-02541) overnight at 37°C and then diluted 1/2 and digested with 0.9 µg of trypsin (Promega, cat # V5113) for eight hours at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113).
-
bioRxiv - Cell Biology 2020Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Biochemistry 2021Quote: ... and the “on-bead-digestion” plate (100 μl 20 mM Tris pH 8.5, Sigma-Aldrich 10708976001, 1 μg/mL LysC, Wako 129-02541, 2 μg/mL Trypsin, Promega V5111). The programmed sequence is ...
-
bioRxiv - Microbiology 2022Quote: ... then diluted 1:5 with nuclease-free water before 2 µL was used as template in a 10 µL GoTaq 1-Step RT-qPCR (Promega, A6020) reaction (69) ...
-
bioRxiv - Developmental Biology 2022Quote: ... for the duration of imaging (approximately 2 minutes per embryo) with the yolk supported in a shallow well of solidified 1% low-melting agarose (Promega, V2111). Adult fish were photographed using a Panasonic DMC GX7 camera with a Panasonic Lumix G 20mm pancake lens ...
-
bioRxiv - Synthetic Biology 2022Quote: To measure luciferase activity on plaque containing LB-agar plates, 5 μl of the diluted (1:50, in PBS) NanoLuc® luciferase substrate 2-furyl methyl-deoxy-coelenterazine (Furimazine; Promega) were dropped onto the respective plaques ...