Labshake search
Citations for Promega :
851 - 900 of 1701 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2024Quote: The apoptotic effect of MK-1775 was determined by means of caspase 3/7 activity via Apotox-Glo Triplex Assay (Promega, #G6320) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: The activity of the proteasome’s β5 sites was determined either by Succinyl(Suc)-LLVY-AMC (7-amido-4-methylcoumarin) fluorogenic substrate or by the Proteasome-Glo™ assay (Promega), a luciferase coupled assay ...
-
bioRxiv - Microbiology 2022Quote: ... DNA from the saliva samples (n=67, one missing) was extracted using the ReliaPrep Blood gDNA Miniprep (Promega, USA). For microbiome profiling ...
-
bioRxiv - Microbiology 2020Quote: ... cell viability was assessed by applying 20 µl of CellTiter 96® AQueous One Solution Reagent (Promega, Madison WI) to each well and incubating for 2 h at 25°C ...
-
bioRxiv - Bioengineering 2020Quote: ... Cell viability was determined using the MTS assay (CellTiter 96® Aqueous One Solution Cell Proliferation Assay, G3580; Promega) according to the manufacturer’s instructions and was calculated as a percentage of the negative control ...
-
bioRxiv - Biochemistry 2020Quote: ... Luciferase activity was measured using ONE-Glo™ Luciferase Assay System according to the manufacture’s protocol (Promega, Madison, WI). The IC50 values were determined by log(inhibitor ...
-
bioRxiv - Cell Biology 2021Quote: ... with two plasmids – one containing the pRL Renilla luciferase gene under the control of the CMV promoter (# E2261, Promega) and the other containing the firefly luciferase gene under the control of the Pomc promoter (−646bp to +65bp ...
-
bioRxiv - Microbiology 2021Quote: ... Infections of 50 000 cells were performed at MOI 2 for HCoV-229E-Renilla (as measured on Huh7.5.1 cells) and infection efficiency was analyzed one day later by measuring Renilla activity (Renilla Luciferase Assay System, Promega).
-
bioRxiv - Microbiology 2021Quote: ... The pellets were then subjected to one freeze-thaw cycle before being resuspended in Passive Lysis Buffer (Promega; E1910). One scoop of 0.15 mm zirconium oxide beads (Next Advance ...
-
bioRxiv - Bioengineering 2020Quote: ... and an absorbance LDH assay (Lactate dehydrogenase assay, CytoTox-ONE™ Homogeneous Membrane Integrity Assay kit from Promega, G7890) was used to determine the level of cytotoxicity caused by membrane compromisation ...
-
bioRxiv - Cancer Biology 2022Quote: The cell viability assay was done using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (Promega, Milano, Italy). It is a colorimetric method for accessing the number of viable cell in proliferation ...
-
bioRxiv - Cancer Biology 2022Quote: The cell proliferation of U87MG and H4 was observed using CellTiter 96® AQueous One Solution Proliferation Assay (Promega). Cells were cultured in a 96-well plate for 72 hours under activation and AZD8055 treatment conditions ...
-
bioRxiv - Pathology 2020Quote: ... One thousand ng of RNA was reverse transcribed to cDNA using reverse transcription reagents (Go Script, Promega, Madison, WI) per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... CellTiter 96® AQueous One Solution Cell Proliferation Assay and Dual-Glo® Luciferase Assay were purchased from Promega Corporation.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... cell viability was monitored using the CellTiter 96® AQueous One Solution Cell Proliferation Assay (Promega, Madison, WI, USA). VeroE6 cells or Huh7.5 cells were plated at 10,000 or 8,000 cells per well of flat bottom 96-well plates ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell viability was measured by MTS/PES One Solution Cell Titer Assay following manufacturer’s protocol (Promega Corp, Madison, WI).
-
bioRxiv - Genomics 2021Quote: ... DNA quantity and quality was verified with the Quantus fluorometer assay (QuantiFluor ONE dsDNA Dye, Promega, Madison, WI, USA) and Femto Pulse® Automated Pulsed Field (Agilent Technologies ...
-
bioRxiv - Developmental Biology 2020Quote: ... a colorimetric MTS assay was performed on HUVECs following the manufacturer’s protocol (CellTiter 96 AQ ueous One Solution Cell Proliferation Assay, Promega) in 96 wells ...
-
bioRxiv - Cancer Biology 2022Quote: Cell viability was quantified using an MTS assay (CellTiter 96 AQueous One Solution Cell Proliferation Assay, Promega, Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Cell viability was determined using Cell Titer 96 AQueous One Solution Cell Proliferation Assay (Promega Corp, Madison, Wisconsin, USA). Data was generated as means of six replicates from two independent experiments +/- SEM.
-
bioRxiv - Molecular Biology 2022Quote: The activity of the NF-κB luciferase reporter cell line was measured according to the manufacturer’s protocol (ONE-GloTM Promega) into 96-well plates with white walls and bottom to reduce the cross-contamination of the signal between wells ...
-
bioRxiv - Microbiology 2022Quote: ... Dual Luciferase reporter assay kit and CellTiter96 Aqueous one solution cell proliferation assay kits were from Promega (Madison, USA). Non-targeting siRNA (Catalog no ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were eluted with TN buffer (10 mM Tris-HCl, pH 8.0, 50 mM NaCl) and quantified using the QuantiFluor ONE dsDNA System (Promega). The resulting barcoded DNA samples were combined in approximately equimolar amounts (a total of 100 femtomoles in 10 µl of TN buffer) ...
-
bioRxiv - Immunology 2022Quote: ... Cell viability was determined using Cell Titer 96 AQueous One Solution Cell Proliferation Assay (Promega Corp, Madison, Wisconsin, USA). Data was generated as means of six replicates from two independent experiments +/- SEM.
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Cat. #G3580, Promega). All experiments were performed in biological triplicates.
-
bioRxiv - Bioengineering 2023Quote: ... One microgram of RNA was converted to cDNA using ImProm-II™ Reverse Transcription System (PROMEGA, Madison, WI, USA) following the manufacturer’s instructions performed on T100™ Thermal Cycler (BIO-RAD) ...
-
bioRxiv - Biochemistry 2023Quote: ... The number of viable cells was determined using CellTiter 96 AQueous One Solution Cell Proliferation Assay kit (Promega G3580) and absorbance at 490 nm was measured by a plate reader (CLARIOstar ...
-
bioRxiv - Molecular Biology 2023Quote: ... The MTS assay was carried out using the CellTiter 96® AQueous One Solution Cell Proliferation Assay (MTS) (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... each sample was digested overnight at 37 °C with one or more of the following enzymes separately: trypsin (Promega), Lys-C (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability was determined using the CellTiter 96 Aqueous One Solution Cell Proliferation Assay (MTS) kit (Cat. #G3580, Promega) at 24 ...
-
bioRxiv - Neuroscience 2023Quote: ... Firefly and Renilla luminescence activities were measured one day after transfection using the Dual Luciferase Reporter Assay System (Promega), following the passive cell lysis protocol.
-
bioRxiv - Immunology 2023Quote: ... and 12 by MTT formazan formation assay by adding 20µL of CellTiter 96 Aqueous One solution (Promega, Catalog#: PAG3580), incubating for 1 hour ...
-
bioRxiv - Neuroscience 2024Quote: ... The pool was quantified by Fluorometry using using the QuantiFluor ONE dsDNA System (Cat# E4871, Promega, Madison, WI, USA) on Quantus instrument (Promega) ...
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Plant Biology 2022Quote: ... The medium was aspirated and fresh medium containing 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS, premixed in 5:1 ratio, Promega) was added to the treated cells ...
-
bioRxiv - Synthetic Biology 2022Quote: ... the tRNA pellet was resuspended in water and incubated with 8 U of RQ1 RNAse-free DNAse (Promega) at 37 °C for 30 min according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... HMW DNA was resuspended in 10 mM Tris pH 8 and quantified by Quantus™ Fluorometer (Promega Inc). The DNA size and integrity were assessed on TapeStation™ instrument (Agilent ...
-
bioRxiv - Plant Biology 2023Quote: ... Gene of interest was amplified using designed primers (Supplementary Table 8) and cloned into pGEMT-Easy vector (Promega). Using the DIG RNA Labelling Kit (Roche Diagnostics) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with 8 µg of pcDNA3.1-GFP-mNLS-K145Q using Fugene 6 Transfection reagent (Promega, E2692) per manufacturer protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 mM Tris-HCl (pH 7), 1% Triton X-100, 1% NaDOC, 100 μg/mL cycloheximide (Applichem, Germany) and 30 U/mL RNase Inhibitor (Promega, United States)] ...
-
bioRxiv - Cancer Biology 2022Quote: Apoptosis induction in response to SRRM1 silencing in leukemia cell lines (25,000 cells/well onto white-walled multiwell luminometer plates) was performed by using Caspase-Glo® 3/7 Assay (Promega Corporation, #G8091) as previously reported (67) ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were collected 24 hours after transfection and mixed with equal volume of Nano-Glo® Luciferase Assay reagent and the relative luminescence (RLU) was measured after 7 minutes using GloMax® 20/20 Luminometer (Promega). The identical cell lysate was then used for protein concentration determination using Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... and viability of the spheroids was determined after 7 days of treatment with the CellTiter-Glo® 3D Cell Viability Assay (Promega G9682) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... SEA (0.2 mg/ml) and soluble schistosomula antigens (0.2 mg/ml) was determined using the Caspase-Glo® 3/7 Assay System (Promega, Sydney, Australia) according to the manufacturers’ instructions.
-
bioRxiv - Cell Biology 2023Quote: ... diluted by the addition of 7 volumes of 25 mM Tris-HCl pH 8.0 and sequencing-grade modified Trypsin (Promega Corp., Madison, WI) was added (0.4 μg/ sample ...