Labshake search
Citations for Promega :
851 - 900 of 2107 citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of ADP Glo Reagent (Promega), supplemented with 0.01% Triton X-100 ...
-
bioRxiv - Genetics 2023Quote: ... and 5 μl of TransFast (Promega; E2431) in a serum-containing medium in a total volume of 500 μl and plated into one well of a 24-well plate ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 µg/mL trypsin (Promega: V511C)) for 1 hour at 25C° and 1000 rpm to partially digest the proteins of the bead–generating an initial eluate ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Systems Biology 2024Quote: ... The digested samples were combined with 5 μL of 6 x 5 LC-MS/MS Peptide Reference mix (Promega) and stored at-20℃ until analysis.
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of random primers (Promega) were added after which the mixture was incubated at 65 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μg of Trypsin (Promega, V5111) was added to each sample and they were incubated shaking at 37°C overnight (o/n) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.25 µl of 2% digitonin (Promega) and 0.5 µl of 10% Tween-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 U GoTaq Flexi Polymerase (Promega) and 0.22 µg TaqStart Antibody (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μL Superasin RNase inhibitor (Promega), and 8 μL PEG8000 (supplied with ligase) ...
-
bioRxiv - Molecular Biology 2020Quote: The commercial psiCHECK™-2 (Promega) vector was modified by deleting the Rluc poly(A ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U μL-1 RNasin (Promega), 1 mM ATP/GTP/CTP ...
-
bioRxiv - Neuroscience 2022Quote: ... The psiCHECK-2 vector (Promega, C8021) was used to build the dual luciferase reporters with Kcnj10 UTRs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 U/μl RNaseIn Plus (Promega) and 10 U/μl SuperScript IV Reverse Transcriptase enzyme while heated ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 µl biotinylated Transcend tRNA (Promega) was included in the reaction mix resulting in biotinylation of lysine residues ...
-
bioRxiv - Cell Biology 2024Quote: ... 2 U RNase-free DNase (Promega), 1 mM CaCl2 ...
-
bioRxiv - Genetics 2024Quote: The psi-CHEK-2 plasmid (Promega) was used for the luciferase assay ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... Sorted nuclei were collected in 5-ml tubes containing 300-500 μl of collection buffer (PBS + 5% BSA) and RNasin Plus RNase inhibitor (Promega). Sorted nuclei were collected by centrifuging at 500g for 10 min at 4°C and processed for downstream analyses (RNA-seq ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μg RNA was incubated at 30 °C for 2 hr in Spodoptera frugiperda (Sf21) extract (Promega) in the presence of [35S]methionine-cysteine (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 20 ng/well of psiCHECK-2 plasmid (psiCHECK-2 Vector (V0) (Promega, C8021) or let-7a-mi6 targeting six regions of the 3ill UTR ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Zoology 2020Quote: ... 10 μL 5× PCR buffer (Gotaq flexi, Promega), 8 μL 25mM MgCl ...
-
bioRxiv - Genomics 2020Quote: ... 5 x RT Improm II reaction buffer (Promega), 50 ng hexanucleotides ...
-
Nucleic acid sensing by STING induces an interferon-like antiviral response in a marine invertebratebioRxiv - Immunology 2022Quote: ... 5 μL of GoTaq qPCR Master Mix (Promega), and 250 nM primer (Supplementary Table S2) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μl NanoGlo substrate (Promega GmbH, Germany, #N1110) diluted 1:100 in the supplied lysis buffer and was mixed with the 50 μl culture in a white 96-well plate and bioluminescence was determined after 3 min incubation using an Orion II Microplate Luminometer (Berthold Technologies GmbH and Co ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of NanoBiT Nano-Glo reagent (Promega N2012 ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl of 5x optimized transcription buffer (Promega), 2 µl of T7 RNA polymerase (20 U.ml-1) ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then 5 ng/μL of trypsin (Promega) was added and samples incubated over night at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mM DTT with sequencing-grade trypsin (Promega) for one hour at room temperature with 1:800 or 1:1600 mass (w/w ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 5 μl of DNase I (Promega, M6101) at 37 °C for 20 min ...
-
bioRxiv - Bioengineering 2023Quote: ... and 5 ng renilla control reporter vector (Promega), using TransIT-X2 transfection reagent (Mirus Bio ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 ng renilla control reporter vector (Promega), mock luciferase ...
-
bioRxiv - Genomics 2024Quote: ... lysed by a 5× reporter lysis buffer (Promega) and incubated overnight at −20°C ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM HaloTag PEG-biotin ligand (G859A; Promega) or an equivalent amount of DMSO was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Genomics 2024Quote: ... extracted from 5 HPVL and 5 LPVL (Table S3, Petersen et al., 2021) were treated with the DNase RQ1 (Promega, US). Then ...
-
bioRxiv - Cell Biology 2022Quote: ... β-arrestin 2 fused at the N-terminus to LgBiT (LgBiT-β-arrestin 2; Promega, plasmid no. CS1603B118) was chosen as it has previously been used successfully with other class B GPCRs ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 µl ViaFect™ (Promega, Madison, WI) and 40 µl Gibco Opti-MEM reduced serum media (Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: The psiCHECK-2 vector (Promega, Cat #C8021) was used to construct plasmids for dual-luciferase reporter assay ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mg/ml proteinase K (Promega, v3021)) at 37 °C overnight followed by addition of 10 μl of 3M potassium acetate and incubation at room temperature for 1h ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 µg of sequencing grade Trypsin (Promega) was added ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 μL RNasin RNase inhibitor (Promega). The transcription reaction was incubated overnight at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... and 2 μg Sequencing Grade Trypsin (Promega). The beads were shaken overnight at 37 °C and pelleted by centrifugation (1,400 rcf ...