Labshake search
Citations for Promega :
801 - 850 of 4716 citations for PCR Genotyping kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... PCR reactions were performed with GoTaq® Hot Start Master Mix (Promega, M5122) using 1 μl of the reverse transcription reaction as template in 20 μl reaction volume ...
-
bioRxiv - Genomics 2019Quote: ... and gel extraction (Wizard™ SV Gel and PCR Cleanup System [Promega A9282]) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were cloned into the pGEM-T Easy vector (Promega, Cat. A1360) and submitted to Sanger sequencing.
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative PCR was performed using the GoTaq qPCR master mix 2x (Promega, #A6001) with a Bio-Rad CFX384 Real-Time thermal cycler ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reaction was performed using the GoTaq PCR master mix (Promega, USA) as per manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2022Quote: ... PCR product was purified and ligated to the pGEM®-T vector (Promega). The construction was transformed into NEB® Turbo competent E ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR amplifications were carried out using the GoTaq Green Master Mix (Promega, Wisconsin) in a reaction volume of 12.5 µL with 5 µL of a 1:20 dilution of the DNA extract as a template ...
-
bioRxiv - Cancer Biology 2022Quote: ... PCR amplification was done using GoTaq G2 Green Master Mix (#M7823, Promega, USA).
-
bioRxiv - Developmental Biology 2022Quote: ... PCR products were cloned into the pGEM-T Easy vector (Promega, Madison, WI). Linearized template DNA (amplified from plasmid with T7/SP6 primers ...
-
bioRxiv - Cell Biology 2022Quote: ... β and γ DNA was next PCR amplified with the Q5 polymerase (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Transfected parasites were analyzed by diagnostic PCR using GoTaq Green master mix (Promega) and the following conditions ...
-
bioRxiv - Immunology 2022Quote: ... A-tailing of purified PCR products was performed using GoTaq polymerase (Promega, UK) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... The PCR products were cloned into the pGL3-Basic (Promega, Madison, WI, USA) vector using a ClonExpress Entry One Step Cloning Kit (Vazyme ...
-
bioRxiv - Immunology 2022Quote: ... and purified with the Wizard SV Gel and PCR Clean-Up System (Promega) after DNA electrophoresis ...
-
bioRxiv - Microbiology 2023Quote: ... The presence of the plasmid was confirmed by colony PCR (GoTaq polymerase, Promega). For construction of ATCC17978Δhcp::aprR ...
-
bioRxiv - Microbiology 2023Quote: ... After purification with the Wizard SV Gel and PCR Clean-Up System (Promega), the template plasmid DNA was digested with DpnI and used in the transformation reaction.
-
bioRxiv - Biochemistry 2023Quote: ... was from American Radiolabeled Chemicals Inc. (St. Louis, MO, USA) and PCR reagents and restriction enzymes from Promega Corporation (Madison ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative RT-PCR was performed with GoTaqβ qPCR and RT-qPCR Systems (Promega) on a CFX384 Real-time System (Bio-Rad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were sub cloned into the pGEM-T-Easy vector (Promega, A1360) using manufactures instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was then performed using the SYBR Green qPCR Master Mix (Promega). Primer sequences are available upon request ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA (1 μL) was PCR amplified in a mastermix of GoTaq Green (Promega) containing specific primers at a final concentration of 0.5 pmol/μL using the cycling conditions ...
-
bioRxiv - Bioengineering 2023Quote: ... The amplicon was purified Wizard SV Gel and PCR Clean-up System (Promega) and was used to produce preselected libraries ...
-
bioRxiv - Bioengineering 2023Quote: ... PCR was performed using either GoTaq G2 Green Master Mix (Cat#M782B, Promega) or Kapa Hifi Hotstart Ready Mix ...
-
bioRxiv - Plant Biology 2023Quote: ... Real-time PCR was performed using Gotaq® qPCR mastermix (Promega, Madison, WI) and a CFX 96 real-time system (Bio-Rad) ...
-
bioRxiv - Plant Biology 2023Quote: ... purified using Wizard® SV Gel and PCR Clean-Up System (Promega, USA), according to the protocol provided by the manufacturer ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR products were cloned in the pGEM T Easy vector system (Promega) according to the manufacturer’s instructions and sequenced (Eurofins Genomics and SourceBioscience) ...
-
bioRxiv - Pathology 2023Quote: ... we performed two overlapping PCR on the RCA products with GoTaq Flexi (Promega) according to the manufacturer’s protocol to amplify the complete genome of MSV using primers targeting MSV-G (PCR#1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and analysed by SYBRG real-time PCR using GoTaq qPCR Master Mix (Promega). Primers used are provided in supplementary Table S2.
-
bioRxiv - Genomics 2023Quote: ... Extracted DNA was used to template PCR reactions with GoTaq polymerase (Promega #M3001) to amplify ITS (primers emITS-1:TGGTAGAGAATGATGGCTGTTG and emITS-4:GCCTCTATGCCTAATTGCCTTT ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR product was first cloned in the pGEM-T Easy vector (Promega) and sequenced ...
-
bioRxiv - Cell Biology 2024Quote: ... The genome-edited monoclonal cell populations were identified by PCR (GoTaq Polymerase, Promega) and then verified by western blot analysis and imaging.
-
bioRxiv - Evolutionary Biology 2024Quote: ... PCR was run for 30 cycles using GoTaq G2 Green master mix (Promega) and specific primers ...
-
bioRxiv - Cell Biology 2024Quote: ... PCR products were sub-cloned into the pGEM-T Easy vector (Promega, A1360) and sequenced ...
-
bioRxiv - Plant Biology 2024Quote: ... The secondary PCR product was cloned in pGEMT-Easy vector (Promega Madison, USA), and Sequencing was performed using the nos promoter’s AP2 and 5’ junction (Eurofins Genomics India Pvt ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR products were verified by sequencing cloned into the pGL3-Control vector (Promega) by Gibson Assembly ...
-
bioRxiv - Molecular Biology 2023Quote: QRT-PCR was performed using the GoTaq qPCR Master Mix (Promega, Cat# A6002) on a QuantStudio 5 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR reactions were performed with GoTaq G2 Flexi DNA Polymerase (Promega, Cat. #M7801) or Herculase II Fusion DNA Polymerase (Agilent ...
-
bioRxiv - Neuroscience 2024Quote: ... PCR was performed with a Gotaq G2 Hot Start Polymerase system (#M7405, Promega). Pyrosequencing was conducted on a Pyromark Q96 Sequencer using matching reagents (#97204 ...
-
Regulation of Diseases-Associated Microglia in the Optic Nerve by Lipoxin B4 and Ocular HypertensionbioRxiv - Molecular Biology 2024Quote: ... and Cd68 were quantified by using GoTaq PCR master mix (Promega, Madison, WI) in OneStep Plus qPCR (Applied Biosystems ...
-
bioRxiv - Genetics 2024Quote: ... Purified PCR products (deletion-bearing, second-step amplicon) and the pGL4.23 vector (Promega) were double digested with NheI-HF (New England Biolabs ...
-
bioRxiv - Biochemistry 2024Quote: ... the PCR products of the Strep-Flag-tag and NLuc (Promega, cat # N1091) were inserted into the pHLmMBP-8 vector (Addgene ...
-
bioRxiv - Biochemistry 2024Quote: ... Untagged CDK2 expression plasmid was cloned by PCR with CDK2-NLuc plasmid (Promega) as the template ...
-
bioRxiv - Plant Biology 2023Quote: ... and purified using Wizard® SV Gel and PCR Clean-Up System (Promega). Next ...
-
bioRxiv - Neuroscience 2023Quote: The PCR fragment were ligated into a pGEM-T Easy Vector System (Promega), transformed into chemically competent cells and sequenced ...
-
bioRxiv - Microbiology 2020Quote: ... Two-rounds of translocation PCR was performed using GoTaq G2 Green Master Mix (Promega). In the first round PCR ...
-
bioRxiv - Neuroscience 2021Quote: ... Probes for in situ hybridization were made by cloning PCR products into pGemTeasy (Promega). 1 µg of the linearized plasmid was transcribed in vitro using NTP labelling mix and T7 or sp6 RNA Polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... Amplicons were purified with Wizard® SV Gel and PCR Clean-Up System (Promega) and sequenced via the Eurofins TubeSeq service ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified using the Wizard SV Gel and PCR Clean-up System (Promega, A9281) as per manufacturer directions ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was performed using the GoTaq qPCR Master Mix (Promega, Cat. M3001) in LightCycler® 480-Roche System according to the supplier’s manual ...
-
bioRxiv - Immunology 2021Quote: ... The PCR products were inserted into the pGEM-T Easy Vector System (Promega, A1360) following the manufacturer’s instructions ...