Labshake search
Citations for Promega :
801 - 850 of 5039 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: Kidney pieces (1/3 of kidney) were homogenized in Passive Lysis Buffer (Promega) containing protease inhibitors (Thermofisher) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and ligated in a 1:3 vector:insert molar ratio using T4 ligase (Promega). Ligations were transformed into JM109 cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rabbit anti-Caspase-3 polyclonal antibody (1:250, Promega/Fisher, PR-G7481) overnight at 4 °C ...
-
bioRxiv - Biophysics 2023Quote: ... Liposomes containing phosphatidylserine and PIP2 (3:1 ratio mol/mol) were purchased (Promega) and prepared to a final concentration of PIP2 at 25 μM ...
-
bioRxiv - Neuroscience 2024Quote: ... human CaV1.3 cDNA (accession number NM_001128840.2) was de-novo synthesized and assembled into a HaloTag vector (Promega G7721) using restriction cloning ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μg of repair template was transfected into 200,000 cells using a 3:1 ratio Fugene6:DNA (Promega), after overnight transfection cells were grown in fresh medium for 6 hours ...
-
bioRxiv - Genetics 2020Quote: ... Colorimetric Cell Viability Kit I (WST-8 reagent, PromoKine, Heidelberg, Germany) and Caspase-Glo® 8 Assay (Promega, Madison, WI) were used for cell viability assay and caspase-8 assay ...
-
bioRxiv - Microbiology 2020Quote: ... Urea was reduced to 1 M by addition of 500 μl AB and overnight digestion was performed at 37 °C with 5 μl of freshly prepared 0.2 μg/μl trypsin (Promega) in AB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The samples were then diluted to 2 M urea final concentration via the addition of 20 mM HEPES pH 8.0 and digested overnight with 5 µg/ml sequence-modified trypsin (Promega) at room temperature.
-
bioRxiv - Microbiology 2020Quote: ... venezuelae macrocolonies that were grown for 30 h at 30°C on MYM agar were pooled and resuspended in 200 µl ice-cold stop solution (5% phenol (pH 4.3) in 98% ethanol) and RNA was isolated using the SV Total RNA Isolation Kit (Promega). After elution ...
-
bioRxiv - Molecular Biology 2021Quote: ... before cells were permeabilized using 0.2% Triton X-100 PBS for 10 min at room temperature, then blocked for 30 min (2% BSA / 0.5% fish skin gelatine / PBST.5, 2U/µL RNAsin Plus (Promega) at room temperature) ...
-
bioRxiv - Immunology 2019Quote: ... and the pellet was resuspended in 20 mL buffer A (NaPO4 20 mM, NaCl 500 mM and imidazole 20 mM, pH 7,4) containing 5 U of DNAse (Promega) and 30 ug/mL lysozyme (Sigma ...
-
bioRxiv - Immunology 2021Quote: ... for 48h after which cells were washed with PBS and lysed with Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysates was measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μL of DNA or 5 μL of cell lysate were mixed with 12.5 μL of GoTaq Colorless Master Mix (Promega), 1 μL of forward and reverse primer (5 μM ...
-
bioRxiv - Cell Biology 2021Quote: ... followed by 5 min quenching with 100 mM glycine and permeabilization with 0.5% Triton X-100 (Promega, Madison, WI) in 1 × PBS for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... Urea was reduced to 1 M by addition of 500 μl AB and overnight digestion was performed at 37 °C with 5 μl of freshly prepared 0.2 μg/μl trypsin (Promega) in AB ...
-
bioRxiv - Biochemistry 2020Quote: ... the samples were brought to room temperature for 5-10 minutes while 2 mL of 30 mM coelenterazine (Promega), or 15 mL of 1-to-50 diluted NanoLuc substrate (Promega) ...
-
PPARγ is a tumor suppressor in basal bladder tumors offering new potential therapeutic opportunitiesbioRxiv - Cancer Biology 2019Quote: ... These cells were transfected 24 h later with 2.5 µg of pcDNA3-PPARγ2 (wild-type or mutated) in the presence of the Fugene HD transfection reagent (Promega). PPARγ2 transient overexpression in the UMUC3 ...
-
bioRxiv - Microbiology 2021Quote: ... Urea was reduced to 1 M by addition of 500 ml AB and overnight digestion was performed at 37°C with 5 ml of freshly prepared 0.2 mg/ml trypsin (Promega) in AB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plates were incubated for 72hr at 37°C with 5% CO2 and then measured by CellTiter-Glo assay (Promega). Briefly ...
-
bioRxiv - Biophysics 2021Quote: ... The reaction was incubated at 30 °C for 5 hours and 2.5 µL of the reaction mix was added to 50 µL of luciferase assay reagent (Promega) pre-equilibrated in room temperature ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... a second jar of xylene for 5 min then incubated in a series of ice-cold solutions with 0.0025% RNasin Plus (Promega): 100% ethanol for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Liquid was removed and gel pieces were dehydrated in 100% ACN at RT for 5 min at 2,000 rpm followed by rehydration in 100 mM NH4HCO3 containing 14 ng/μL trypsin (Promega) on ice for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... and the PCR products of 5’ RACE were cloned using pGEM®-T Easy Vector Systems (Promega, WI, USA). Purified PCR fragments and pGEM cloning 5’-terminal sequence of BToV were sequenced using primers designed for every ∼300 bp of the BToV genome ...
-
bioRxiv - Microbiology 2021Quote: ... Ten nanograms of template DNA was added to 5 μl Green GoTaq Reaction Mix Buffer (Promega, Madison, Wisconsin, USA), 1.25 units of GoTaq DNA Polymerase (Promega ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplifications were carried out in a total reaction volume of 10μL containing 5 μL of 2xGoTaq master mix (Promega) and 2.5 μL of 4M betaine ...
-
bioRxiv - Cell Biology 2019Quote: ... proteins were trypsinised on the beads in 60 μl of Buffer I (2 M urea, 50 mM Tris-HCl pH 7.5, 5 μg/ml Trypsin [modified sequencing-grade trypsin; Promega]) for 30 min at 37°C in a thermomixer ...
-
bioRxiv - Plant Biology 2020Quote: ... proteins were precipitated overnight with 5 volumes of cold 0.1 M ammonium acetate in 100% methanol and digested with sequencing-grade trypsin (Promega) and each sample was analyzed by nanoLC-MS/MS on a QExactive+ mass spectrometer coupled to an EASY-nanoLC-1000 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... in DEPC-treated phosphate buffer (PB) with 0.5% Triton X-100 supplemented with RNasin (40Ul/µl stock, 5 ml/ml of buffer, Promega). We rinsed sections ...
-
bioRxiv - Biochemistry 2019Quote: ... All samples were further diluted with 20 mM HEPES pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 μg trypsin (V5111, Promega) (1/100 ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK cells were transfected with 5’UTR-reporters for 24h using ViaFect reagent according to the manufacturer’s protocol (Promega). Next ...
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2022Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Systems Biology 2023Quote: ... cooled on ice to room temperature for 5 min and digested overnight at 37 °C with 0.5 μg of sequencing-grade trypsin (Promega). Peptide mixtures were acidified to pH 3 with 1.5 µl 5% FA ...
-
bioRxiv - Molecular Biology 2023Quote: ... After incubation at 37 °C/5 % CO2 for 20 h 40 nl HaloTag® NanoBRET™ 618 Ligand (PROMEGA) was added to the cells using an Echo acoustic dispenser (Labcyte ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Immunology 2023Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... DNA from My-La cells was amplified by use of primers GATA3_AICE_KpnI s 5’-GCGGTACCATACAGACCCTTCCAGCCAC and GATA3_AICE_XhoI as 5’-GCCTCGAGAACAGATGTGGGGAGTCAGA and cloned via KpnI and XhoI into the multiple cloning site (MCS) of pGL3 (Promega). All constructs were verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were further diluted with 50 mM Tris pH 7.9 pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Immunology 2023Quote: Promoter constructs were created by cloning the immediate 4.5-kb region adjacent to the 5’ TSS of SPINK7 into the promoterless Nano-luciferase reporter vector pNL1.1-NL (Promega). The 4.5-kb sequence and subsequent constructs were created by using primers with the restriction enzyme sites KpnI-HF and XhoI ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 µL of the supernatant were diluted in 45 µL of Luciferase Assay Reagent (Luciferase Assay System, E1500, Promega) and measured at a Synergy HT reader (BioTek ...
-
bioRxiv - Cancer Biology 2023Quote: ... beads were reconstituted in 5 μL 50 mM HEPES pH 8.0 buffer containing trypsin/rLys-C enzyme mix (Promega) at a 1:25 enzyme to protein ratio ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the equivalent region in the human (−207/+5) were cloned into pGL3-basic Luciferase reporter-vector (E1751, Promega) using the forward primer containing XhoI restriction site ...
-
bioRxiv - Molecular Biology 2024Quote: ... 400 μl cold cell lysis buffer (20 mM HEPES, pH 7.4, 100 mM KCl, 5 mM, MgCl2, 500U/ml RNasin-Plus (Promega), 1x protease inhibitor cocktail (200X ...
-
bioRxiv - Cancer Biology 2024Quote: ... a multiplexed caspase/viability assay was performed as described before [5] using the Multiplex Assay ApoLive-Glo (Promega, G6411) kit.
-
bioRxiv - Molecular Biology 2021Quote: ... Fujifilm) and then incubated for 8 h at 37 °C with sequence-grade trypsin (1□g; Promega, Madison, Wisconsin). Peptides were desalted on Ultra Micro Spin Columns C18 (The Nest Group Inc. ...
-
bioRxiv - Cancer Biology 2022Quote: ... Precipitates were solubilised in 8M urea (20mM HEPES, pH 8) and digested with Lysine C (1:50 ratio; Promega) for 4h at 37C in 6M urea followed by an overnight trypsin digestion (1:25 ratio ...
-
bioRxiv - Immunology 2021Quote: ... 8 U RNasin Ribonuclease Inhibitor (Promega, Cat#N2115), and 3 U Recombinant RNase Inhibitor (Takara ...