Labshake search
Citations for Promega :
801 - 850 of 5055 citations for 6 9 Methano 4 1 benzoxazepin 2 3H one octahydro 3 methyl 3 α 5a bta 6 bta 9 bta 9a bta 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... JEG-3 viability after 1 h salubrinal pretreatment followed by 48 h ZIKV infection was measured by CellTiter-Glo Assay (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... The cells were then washed three times with 1 × PBS and blocked with 3% Blot-Qualified bovine serum albumin (BSA, Promega) in 1 × PBS containing 0.05% Tween-20 (TPBS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA-TBST for 1h at room temp ...
-
bioRxiv - Molecular Biology 2022Quote: ... The SELENOP 3’UTR and the control plasmid were linearized using Bsb 1 and in vitro transcribed using the Ribomax kit (Promega). The RNA was then purified using p30 size exclusion columns (Bio-Rad ...
-
bioRxiv - Microbiology 2021Quote: ... The cytotoxicity of compounds (100 uM to 1 uM, 3-fold dilution) was examined using the CellTiter-Glo Luminescent Cell Viability Assay (Promega). Cell cytotoxicity data was normalized to DMSO control as 0% cell death.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Immunology 2023Quote: ... prepared by combining ONE-Glo™ EX Luciferase Assay Buffer with ONE-Glo™ EX Luciferase Assay Substrate in 1:1 ratio (Promega, USA). After measuring the signal of the Firefly luciferase in the GloMax® 20/20 Luminometer (Promega ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 6-8 hours before dual luciferase assay was performed using the Dual-Glo Luciferase Assay (Promega) in a Synergy Neo2 microplate reader (Biotek).
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid transfection of U2OS cells with PIF1 variants was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were plated at 100,000cells in 2 ml media onto 35mm MatTek glass bottom dishes and transfected with 0.9µg RUSH plasmid and 0.1µg eGFP-GalT or LAMP1-GFP using 100µl Opti-MEM and 3µl Fugene 6 transfection reagent (Promega) one day before imaging ...
-
bioRxiv - Molecular Biology 2019Quote: ... Instrument quality control was monitored using the Promega 6×5 LC-MS/MS Peptide Reference Mix (Promega) before and after each MS experiment run ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were washed again and 6 µg of plasmid DNA was added with FugeneHD transfection reagent (Promega). Supernatants were collected at 24 ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6 uL of RNA was used for each cDNA synthesis (GoScript™ Reverse Transcription System kit, Promega). qPCR was performed using Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... following manufacturer’s guidelines and a ratio of 0.5 µg of plasmid:1.5 µL FuGene 6 (Promega, E2691) in Opti-MEM (Gibco) ...
-
bioRxiv - Biochemistry 2020Quote: ... HeLa cells were transiently transfected with the PX459–sgRNF213-exon3 vector using FuGENE 6 Transfection Reagent (Promega). Forty-eight hours post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection was done on pre-seeded HeLa cells (70% confluency) with the FuGENE 6 Transfection Reagent (Promega) following standard protocol ...
-
bioRxiv - Cell Biology 2022Quote: eGFP-HSP27 immunoprecipitations were performed in p62KO HeLa cells 24hrs following transient transfection using Fugene 6 (Promega). HeLa cells were treated with 750µM LLOMe for 2hrs prior to immunoprecipitation ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Piezo2 (Lewis et al., 2017): 2.5 µg + 0.5 µg YFP) with Fugene 6 (Promega, Madison, WI) 48 hours prior to recording at a transfection ratio of 10 µL Fugene6:3 µg total DNA ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.25 μg vesicular stomatitis virus G glycoprotein expression plasmids using the Fugene 6 transfection reagent (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... in 6-well plates with pActin-Gal4 and pUAS-Lgr4 vector using Fugene-HD (Cat. # E2311, Promega). Twenty-four hours after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... and then they were transfected with the expression plasmid DNAs by using FuGENE 6 (Promega, Madison, WI).
-
bioRxiv - Cancer Biology 2023Quote: ... into HEK293T cells in 57 µL Opti-MEM and 6 µL FuGENE HD (Promega, Fitchburg, WI, USA) transfection reagent as described (Gerstmeier et al ...
-
bioRxiv - Systems Biology 2024Quote: ... FuGene 6 (cat#: E2692) transfection reagent and sequencing grade modified trypsin (cat#: V5111) were purchased from Promega. Cas9 endonuclease was purchased from Integrated DNA Technologies ...
-
A CRISPR activation screen identifies FBXO22 as an E3 ligase supporting targeted protein degradationbioRxiv - Biochemistry 2023Quote: ... FuGene 6 (cat#: E2692) transfection reagent and sequencing grade modified trypsin (cat#: V5111) were purchased from Promega. Cas9 endonuclease was purchased from Integrated DNA Technologies.
-
bioRxiv - Developmental Biology 2020Quote: ... Digests were carried out in 4M urea 100mM HEPES with LysC (Wako, #121-05063, 1/100 (w/w) protease/substrates) for 3 h at 37C and subsequent trypsin digest (Promega, #V5280, 1/100 (w/w) protease/substrates ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 75 μL (1:1 volume) of One-Glo™ reagent (E6110, Promega) was added to each well ...
-
bioRxiv - Microbiology 2020Quote: ... Assays were harvested on day 3 using BrightGlo luciferase reagent (Promega, Madison, WI) and luminescence detected with a Victor luminometer (PerkinElmer ...
-
bioRxiv - Pathology 2019Quote: ... RNA (3 μg) was retro-transcripted by using M-MLV (Promega, Madison, WI). qPCR was performed in triplicate by using validated qPCR primers (BLAST) ...
-
bioRxiv - Cancer Biology 2020Quote: Cell death was analyzed using Caspase-Glo 3/7 Assay (Promega, Madison, WI), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... was measured using the Caspase-Glo-3/7 kit ((Promega, Madison, WI, USA). The luminescence assay was measured using Biotek Synergy H1 microplate reader (Biotek ...
-
bioRxiv - Biochemistry 2022Quote: ... ~2.5 μg recombinant bacmid DNA and 3 μl FuGENE HD Transfection reagent (Promega) in 100 μl Sf900 II media (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were embedded in 3% low melting point agar (Promega, Madison, WI, USA). Formalin embedding ...
-
bioRxiv - Neuroscience 2019Quote: ... caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega). Cell viability was detected using the CytoPainter Live Cell Labeling Kit (Abcam ...