Labshake search
Citations for Promega :
801 - 850 of 3835 citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... 5 mM MgCl2 (pH 7) and 40 U RNasin® Ribonuclease Inhibitor (Promega) at 37° C 60 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 hr after stimulation using Nano-Glo® Luciferase Assay System (Promega). For each time point 200,000 cells were tested in triplicate for each cell line.
-
bioRxiv - Bioengineering 2021Quote: ... or PG48 at 5% molar ratio were incubated with trypsin gold protease (Promega) at 37 °C ...
-
bioRxiv - Genomics 2022Quote: ... Each 5 μL fraction sample was treated with DNase I (cat #M6101, Promega) for 1 h at 37°C and then diluted 1:20 in 50 μg/mL yeast tRNA (cat #Am7119 ...
-
bioRxiv - Neuroscience 2022Quote: ... The samples were then digested with 5 μg of trypsin (Promega, Sequence Grade). After an ON incubation at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µg of total RNA were treated with RQ1 RNase-free DNAse (Promega) for 2h at 37°C ...
-
bioRxiv - Microbiology 2020Quote: ... and T7 RNA polymerase as well as 5 μL RNasin RNase inhibitor (Promega). Transcription reactions were left overnight ...
-
bioRxiv - Molecular Biology 2020Quote: ... Each reaction contained 5 μL of 2x SYBR Green mastermix (Promega, Benelux BV), 2.5 μL primer mix (forward and reverse ...
-
bioRxiv - Cancer Biology 2023Quote: ... Livers were incubated using Luciferase Cell Culture Lysis 5 x Reagent (Promega, E1531) according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A total of 5 μL per well of 20x-NanoBRET Tracer K10 (Promega) at 10 μM for CSNK2A1 or 5 μM for CSNK2A2 in Tracer Dilution Buffer (Promega N291B ...
-
bioRxiv - Cell Biology 2024Quote: ... A total of 5 µL per well of 20x-NanoBRET Tracer K10 (Promega) at 5 µM in Tracer Dilution Buffer (Promega N291B ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were directly spiked with 5 pg of unmethylated lambda phage DNA (Promega) and subjected to bisulfite treatment and library construction using the post-bisulfite adaptor tagging (PBAT ...
-
bioRxiv - Cell Biology 2024Quote: ... RNAs were incubated with [5’-32P] pCp and T4 RNA ligase (Promega, M1051) O/N at 4 °C ...
-
bioRxiv - Immunology 2024Quote: ... 5 mg purified RIPR protein fragment was incubated with TEV protease (Sigma/Promega) at a 1:10 v/v ratio overnight at 4 °C on a rolling mixer ...
-
bioRxiv - Biochemistry 2022Quote: ... and impregnated with 75 µL of 5 ng/µL trypsin (trypsin gold; Promega) solution overnight at 37°C ...
-
bioRxiv - Plant Biology 2024Quote: ... containing 5 μL di GoTaq® Green Master Mix (Promega, Madison, WI, USA), 1 μL of each primer 10 μM and 1 μL of template DNA and using a MyCycler Thermal Cycler (BioRAD ...
-
bioRxiv - Biochemistry 2024Quote: ... After incubating cells for 10 min with 5 μM coelenterazine-h substrate (Promega), bioluminescence was measured at 535/30 nm and 475/30 nm using a PHERAstar plate reader (BMG) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2020Quote: ... 50000 viable cells were pelleted and lysed in Resuspension buffer (Tris-HCl pH 7.4 10 mM, NaCl 10 mM, MgCl2 3 mM, NP40 0.1%, Tween-20 0.1%, digitonin 0.01% - Promega #G9441) for 3 min on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was assayed with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) colorimetric assay (Promega) per manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cancer Biology 2024Quote: ... Spheroids were treated as indicated for 3 days and viability was measured using 3D CellTiter-Glo (#G9682, Promega) and a GloMax luminometer (Promega).
-
bioRxiv - Microbiology 2024Quote: ... cells were washed 3 times with PBS and lysed with 100 µL of 0.05% Triton X-100 (Promega). The contents of the well were serially diluted ...
-
bioRxiv - Microbiology 2024Quote: ... cells were washed 3 times with PBS and lysed with 100 µL of 0.05% Triton X-100 (Promega). The contents of the well were serially diluted ...
-
bioRxiv - Microbiology 2024Quote: ... Concentrated protein extracts were then digested with 3 µl trypsin according to manufacturer’s instruction (Promega, Madison, WI, USA) at 37 °C overnight ...
-
bioRxiv - Neuroscience 2024Quote: ... the wild type and mutated Nnat 3’UTR was inserted into a pmirGLO dual-luciferase expression vector (Promega). Detailed description of the design of these constructs and of the rescue constructs are listed in the supplementary material section ...
-
bioRxiv - Plant Biology 2024Quote: ... At least 3 independent technical experiments were performed from each RNA sample using SYBR Green Master Mix (Promega) with Chromo4 Real-Time PCR Detection System (Bio-Rad) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Apoptotic cell count was measured as described above using the Caspase-Glo® 3/7 3D Assay (Promega). Bliss synergy scores were calculated using the SynergyFinder web application (version 3.0)61.
-
bioRxiv - Biophysics 2024Quote: ... UCSD) was transiently transfected into RPE1 cells to labeling peroxisomes for 2 or 3 days using Viafect (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2024Quote: ... Further confirmation of apoptosis was performed using the Caspase-Glo 3/7 Assay (Promega UK, Cat No:8091) system ...
-
bioRxiv - Developmental Biology 2021Quote: ... embryos were co-injected with 5 pg of pRL-TK:renilla luciferase plasmid (Promega E2241) + 50 pg of the pGL4.23 luc2/miniP enhancer:luciferase plasmid and the following amounts of MOs or mRNAs into each dorsal marginal zone (dmz ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were subjected to a pulse with 5 µM biotin-HaloTag ligand (G828A, Promega) diluted in complete medium for 3 hours ...
-
bioRxiv - Genomics 2020Quote: ... 5 μL GoTaq® Probe qPCR Master Mix with dUTP (2X) (Promega, Madison, WI), 0.2 μL GoScript™ RT Mix for 1-Step RT-qPCR (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... alongside 5 µl of broad molecular weight protein marker (Broad Range Molecular Marker, Promega), was loaded onto the gel and run at 200 volts for 55 minutes using a Mini-PROTEAN Electrophoresis System (Bio-Rad ...
-
bioRxiv - Plant Biology 2022Quote: ... Cells were collected and lysate in BugBuster (EMDMillipore) with 5 ul RQ1 DNase (Promega). The supernatant was flowed through a column packed with Ni-NTA (QIAGEN) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were allowed to grow for 5 days before adding an MTS reagent (Promega) and measuring absorbance at 492 nM on a BioTek Synergy H1 microplate reader (BioTek Instruments ...
-
bioRxiv - Genetics 2020Quote: Full-length wild-type and mutant Csde1 5’UTRs were inserted pGL3 (Promega, E1751) plasmid in between EcoRI and NcoI sites upstream of Firefly luciferase gene ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were incubated at 25°C for 5 days before CellTiter-Glo assays (Promega) were performed ...
-
bioRxiv - Neuroscience 2023Quote: ... transferred to opaque 96-well plates containing 5 μM furimazine (NanoLuc Luciferase Assay, Promega), and bathed in 5-HT at various concentrations (ranging from 0.1 nM to 1 mM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2ul/5-10mg DW of Trypsin/Lys-C (Endoproteinase LysC) Mix (Promega, Cat #V5071) was added to samples and incubated with continuous agitation at 150 rpm for overnight at 37°C ...