Labshake search
Citations for Promega :
751 - 800 of 1062 citations for Neuronal acetylcholine receptor subunit alpha 5 NACHRA5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Samples were then diluted with water (1:5) and incubated overnight at 37°C with 0.5 µg of sequencing grade modified trypsin (Promega). Samples were acidified using 1% TFA and peptides separated into 3 fractions on a 200 µL StageTips packed with three Empore™ SPE Disks SDB-RPS (3M ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... a second jar of xylene for 5 min then incubated in a series of ice-cold solutions with 0.0025% RNasin Plus (Promega): 100% ethanol for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Liquid was removed and gel pieces were dehydrated in 100% ACN at RT for 5 min at 2,000 rpm followed by rehydration in 100 mM NH4HCO3 containing 14 ng/μL trypsin (Promega) on ice for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... and the PCR products of 5’ RACE were cloned using pGEM®-T Easy Vector Systems (Promega, WI, USA). Purified PCR fragments and pGEM cloning 5’-terminal sequence of BToV were sequenced using primers designed for every ∼300 bp of the BToV genome ...
-
bioRxiv - Microbiology 2021Quote: ... Ten nanograms of template DNA was added to 5 μl Green GoTaq Reaction Mix Buffer (Promega, Madison, Wisconsin, USA), 1.25 units of GoTaq DNA Polymerase (Promega ...
-
bioRxiv - Pathology 2022Quote: ... G490 5 × All-In-One RT MasterMix (abm) was used for reverse transcription according to the manufacturer’s protocol (Promega). The qRT-PCR analysis was performed in 96-well plates using the BIO-RAD CFX96 detection system ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Immunology 2022Quote: ... Transduced cells were incubated for 24 hours at 37°C/5% CO2 and luminescence measured by addition of 40μl of ONE-Glo reagent (Promega) with detection using a Tecan Spark plate reader ...
-
bioRxiv - Plant Biology 2019Quote: ... PCR amplifications were carried out in a total reaction volume of 10μL containing 5 μL of 2xGoTaq master mix (Promega) and 2.5 μL of 4M betaine ...
-
bioRxiv - Cell Biology 2019Quote: ... proteins were trypsinised on the beads in 60 μl of Buffer I (2 M urea, 50 mM Tris-HCl pH 7.5, 5 μg/ml Trypsin [modified sequencing-grade trypsin; Promega]) for 30 min at 37°C in a thermomixer ...
-
bioRxiv - Plant Biology 2020Quote: ... proteins were precipitated overnight with 5 volumes of cold 0.1 M ammonium acetate in 100% methanol and digested with sequencing-grade trypsin (Promega) and each sample was analyzed by nanoLC-MS/MS on a QExactive+ mass spectrometer coupled to an EASY-nanoLC-1000 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... in DEPC-treated phosphate buffer (PB) with 0.5% Triton X-100 supplemented with RNasin (40Ul/µl stock, 5 ml/ml of buffer, Promega). We rinsed sections ...
-
bioRxiv - Biochemistry 2019Quote: ... All samples were further diluted with 20 mM HEPES pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 μg trypsin (V5111, Promega) (1/100 ...
-
bioRxiv - Genomics 2021Quote: The supernatant was magnetically removed and the beads were resuspended in 20 µl of L3 DNA linker ligation mixture (8 µl water, 5 µl 4X ligation buffer, 1 µl RNA ligase [New England Biolabs], 0.5 µl RNasin [N2615, Promega GmbH] ...
-
bioRxiv - Microbiology 2021Quote: ... seriolae gDNA was extracted from 5-day old cultures using the Wizard® Genomic DNA Purification Kit (Promega, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK cells were transfected with 5’UTR-reporters for 24h using ViaFect reagent according to the manufacturer’s protocol (Promega). Next ...
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2021Quote: ... Luminescence was measured after 20 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Immunology 2022Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... 1–5 µl of gDNA was mixed with 0.5 µl of 10 mM dNTP mix (Promega, C1141, Madison, WI), 10 µl of 25 mM MgCl2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... 400 μl cold cell lysis buffer (20 mM HEPES, pH 7.4, 100 mM KCl, 5 mM, MgCl2, 500U/ml RNasin-Plus (Promega), 1x protease inhibitor cocktail (200X ...
-
bioRxiv - Neuroscience 2024Quote: ... 1–5 µl of gDNA was mixed with 0.5 µl of 10 mM dNTP mix (Promega, C1141, Madison, WI), 10 µl of 25 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... a multiplexed caspase/viability assay was performed as described before [5] using the Multiplex Assay ApoLive-Glo (Promega, G6411) kit.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 5 µL of the supernatant were diluted in 45 µL of Luciferase Assay Reagent (Luciferase Assay System, E1500, Promega) and measured at a Synergy HT reader (BioTek ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay Virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Orsay virus RNA1 level was quantified by qPCR using 1 μl of 1/5 diluted cDNA (GoTaq Promega A6001) and run on QuantStudio 3 Real Time PCR system (RNA1 qPCR primers GW194 and GW195)23.
-
bioRxiv - Systems Biology 2023Quote: ... cooled on ice to room temperature for 5 min and digested overnight at 37 °C with 0.5 μg of sequencing-grade trypsin (Promega). Peptide mixtures were acidified to pH 3 with 1.5 µl 5% FA ...
-
bioRxiv - Molecular Biology 2023Quote: ... After incubation at 37 °C/5 % CO2 for 20 h 40 nl HaloTag® NanoBRET™ 618 Ligand (PROMEGA) was added to the cells using an Echo acoustic dispenser (Labcyte ...
-
bioRxiv - Immunology 2023Quote: ... Luminescence was measured after 22 hours of incubation at 37°C with 5% CO2 with a luminometer using the Bio-Glo-TM Luciferase Assay Reagent according to the manufacturer’s instructions (Promega).
-
bioRxiv - Cancer Biology 2022Quote: ... DNA from My-La cells was amplified by use of primers GATA3_AICE_KpnI s 5’-GCGGTACCATACAGACCCTTCCAGCCAC and GATA3_AICE_XhoI as 5’-GCCTCGAGAACAGATGTGGGGAGTCAGA and cloned via KpnI and XhoI into the multiple cloning site (MCS) of pGL3 (Promega). All constructs were verified by sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... Samples were further diluted with 50 mM Tris pH 7.9 pH 8.0 to a final urea concentration of 2 M and proteins were digested with 5 µg trypsin (Promega) (1/100 ...
-
bioRxiv - Immunology 2023Quote: Promoter constructs were created by cloning the immediate 4.5-kb region adjacent to the 5’ TSS of SPINK7 into the promoterless Nano-luciferase reporter vector pNL1.1-NL (Promega). The 4.5-kb sequence and subsequent constructs were created by using primers with the restriction enzyme sites KpnI-HF and XhoI ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) inner salt (Promega) was added to each well and the plate was further incubated for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... About 5 µg of the purified mRNA was used to generate cDNA using the Go script kit (Promega #A5001). The KRAS coding region was amplified using a pair of primers Kras_Exon1-F (5’ CCGCCATTTCGGACTGGGAGCGAGCGC 3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 μL of [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] (MTS) (Promega, #G3582) were added and incubated at 37°C for 3 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... beads were reconstituted in 5 μL 50 mM HEPES pH 8.0 buffer containing trypsin/rLys-C enzyme mix (Promega) at a 1:25 enzyme to protein ratio ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using primers listed in Supplementary Table 5 and products cloned using the pGEM-T Easy Vector System I (Promega) or Phusion HF DNA polymerase (NEB ...
-
bioRxiv - Immunology 2024Quote: ... plates were washed 5 times with wash buffer (PBS with 1% BSA (Capricorn Scientific) and 0.05% Tween-20 (Promega)) ...
-
bioRxiv - Physiology 2024Quote: ... Lysates were diluted using one volume of dilution buffer (10 mM Tris pH 8, 0.4% NP40, 5 mM CaCl2, 2 U/mL RQ1 DNAse (Promega)) and then incubated with anti-Flag or anti-p400 antibodies coupled to agarose beads (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... The coding sequence of NanoLuc was amplified by PCR using the primers 5-NanoL and 3-NanoL from pNL1.1.CMV plasmid (Promega). The resulting fragment was digested with BamHI and NotI enzymes and cloned into pEGFP-N1 digested with the same enzymes ...
-
bioRxiv - Biophysics 2024Quote: ... The next day cells were treated with compounds and assessed for cell growth 5 days later using CellTiterGlo (Promega).
-
bioRxiv - Cell Biology 2024Quote: ... 5 regions of ieCTNNB1 and the region containing the mutation site were respectively cloned into pGL3- promoter vector (Promega). HEK293T ...
-
bioRxiv - Biochemistry 2024Quote: ... immune precipitated samples were washed 5 times with lysis buffer and treated with Trypsin Gold (2 μg/ml; Promega) in 20 mM Tris-HCl (pH7.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... Transfection was performed at ∼5 DIV after half-replacing the medium with fresh proliferation medium using Fugene 6 (Promega) with the following ratio ...
-
bioRxiv - Systems Biology 2024Quote: ... Proteins were digested with 5 µL of 100 mM Ambic pH 8.8 that contained ∼250 ng/µL of Trypsin/rLysC enzyme mix (Promega) (Total amount 1.25 µg ...
-
bioRxiv - Neuroscience 2021Quote: ... Blots were washed 3 times in TBST for 5 minutes and further incubated with HRP-conjugated secondary anti-mouse-IgG-H&L chain (Promega) or anti-rabbit-IgG-F(ab’)2 (GE Healthcare ...
-
bioRxiv - Cancer Biology 2021Quote: ... Proteins were digested overnight at 37 °C with 5 μL of trypsin (1 μg dissolved in 50 mM HEPES pH 8.0, Promega V5111). The trypsin digestion was quenched by adding 4 μL of 1× EDTA-free protease inhibitor cocktail (Roche 11873580001) ...
-
bioRxiv - Cancer Biology 2019Quote: ... diluted 1:5000 in 5% milk in TBST were used for detection by the addition of an enhanced chemiluminescence (ECL) substrate (Promega). Western blot quantification was performed using Fiji software (Schindelin et al. ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 10 μg of each protein was then boiled in PCR tubes at 100 °C for 5 min and allowed to cool to room temperature before 1 μg mass spectrometry-grade trypsin (Trypsin Gold from Promega) was added to each sample ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse mutant primer oIMR1437 5′-TCC ACC TAG CCT GCC TGT AC-3′) with 1U GoTaq polymerase (Promega, Madison, USA), 1X green GoTaq buffer ...