Labshake search
Citations for Promega :
751 - 800 of 3283 citations for 8 Chloro 2 chloromethyl imidazo 1 2 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... gondii glyceraldehyde 3-phosphate dehydrogenase 2 (GAPDH2, ML5049/ML5680) or TgAPT1 (ML4097/ML4098) were used for subsequent PCR amplification with GoTaq polymerase (Promega) for twenty-five cycles as follows ...
-
bioRxiv - Microbiology 2023Quote: Vero E6 cells were transfected with an GFP expression vector together with either a control expression vector (no spike) or a SARS-CoV-2 spike expression vector using Fugene (Promega). Two hours after transfection ...
-
bioRxiv - Cell Biology 2023Quote: Protein-protein interactions between Mkl1/2 and Foxo1/3/4 or glucocorticoid receptors were also measured using NanoBiT PPI Starter Systems (Promega). 293FT cells were seeded in 96-well white wall microplates and co-transfected with the LgBiT and SmBiT plasmids ...
-
bioRxiv - Systems Biology 2023Quote: ... The panel of ssDNA-labelled antibodies (250 ng/ml for each antibody) was mixed with 2 U/µl RNAsin Plus (Promega) and 0.1% Triton X-100 in PBS:PFBB (1:1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR fragment was directionally cloned downstream of the Renilla luciferase ORF in the psiCHECK-2 vector (Promega, Madison, US) using the Quick Ligase kit (M2200 ...
-
bioRxiv - Biochemistry 2023Quote: ... supplemented with 4% FBS and 100 µL were seeded per well in 96-well plates at a density of 2×105 cells/mL in the presence or absence of 0.1 mM HaloTag NanoBRET™ ligand (Promega). The following morning ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated from 20-100 ng of RNA using the GoTaq 2-step RT-qPCR System (Promega, cat# A6110). qPCR was performed with SYBR Green on a StepOnePlus real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... Intracellular fluorescence was monitored after 2 and 3 h of nanoalgosome incubation by spectrofluorimetric analysis using a microplate reader (Glomax, Promega). As vehicle-control ...
-
bioRxiv - Microbiology 2024Quote: ... Tat and Rev and plasmid encoding spike of SARS-CoV-2 variants Delta or Omicron were transfected in HEK 293T cells using Fugene6 reagent (Cat. No. E2691, Promega) following manufacturer’s guidelines ...
-
bioRxiv - Pathology 2024Quote: ... The samples were diluted with 50 mM TEAB buffer to a final Urea concentration of 2 M before adding trypsin (Promega) in an enzyme:substrate ratio of 1:75 and incubating at 25 °C for 16 hours ...
-
bioRxiv - Immunology 2024Quote: ... 48 hours later the media was removed and replaced with 25 µL of RMPI-1640 media supplemented with 2% low-IgG FBS (Promega). Antibodies were serially diluted 1:10 in RPMI 1640 media from a starting concentration of 30 µg/mL to a final concentration of 0.014 µg/mL and 25 µL of antibody dilution was added to the plate ...
-
bioRxiv - Cell Biology 2023Quote: ... dilute with 4 volumes of 20 mM Tris-HCl pH8 / 2 mM CaCl2 before overnight digestion at room temperature with 100 ng sequencing grade trypsin (Promega). Samples were centrifuged ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were pre-incubated in Hanks’ balanced salt solution with increasing concentrations of compound for 60 minutes before stimulation with 10 nM CXCL12 and addition of 2 µM Renilla Luciferase substrate coelenterazine-h (Promega). After 20 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... Tryptic samples were subsequently diluted to 2M urea in 100mM Tris/HCl pH 8 and digested over night at 37°C (Promega, enzyme:protein 1:100). Samples were adjusted to pH 2 using 10% trifluoroacetic acid (TFA ...
-
bioRxiv - Immunology 2022Quote: ... Caspase-Glo® 8 and Caspase-Glo® 9 (all Promega) kits were used as previously described (57) ...
-
bioRxiv - Molecular Biology 2019Quote: 25μL of Caspase-Glo®-3/7 or −8 reagent (Promega) was added to 5μg (Caspase-3/7 activity ...
-
bioRxiv - Microbiology 2020Quote: ... 8 hpi cells were lysed in Cell Culture Lysis Reagent (Promega). Lysates were combined with Luciferase Substrate (Promega ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used Caspase-Glo 3/7 and 8 assay systems (Promega). Approximately 2.0 × 103 cells/well were seeded in a 96-well plate and (1 ...
-
bioRxiv - Genetics 2024Quote: ... Proteins were immediately solubilized in 8 M urea and tryptic (Promega) digestion was performed overnight at 37°C with shaking followed by desalting ...
-
bioRxiv - Cancer Biology 2024Quote: ... or using Caspase-Glo® 8 Assay Systems® (Promega, G8200) to measure cleaved Caspase 8 activity.
-
bioRxiv - Microbiology 2019Quote: ... gel pieces were dried in a vacuum concentrator and re-swollen with 2 ng/μl trypsin solution (sequencing grade trypsin, Promega, USA) followed by overnight digestion at 37 °C ...
-
bioRxiv - Physiology 2020Quote: ... and single-stranded cDNA was synthesized from each sample (2 μg) with M-MLV reverse transcriptase (#0000113467, Promega Corporation, Fitchburg, WI) and RNase inhibitor (40 U ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) dye reduction assay as described previously [20] or by CellTiterGlo assay (Promega, Walldorf, Germany) following the manufacturer’s instructions after 120h incubation.
-
bioRxiv - Immunology 2021Quote: ... Products were isolated from a 2% agarose gel using the Wizard1 SV Gel and PCR Clean-Up System (Promega, Mannheim, Germany). DNA concentration was determined via the Qubit1 1.0 Fluorometer (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: We performed the apoptosis analysis of the MPro stable cells and cells transiently transfected with the pLVX-MPro-eGFP-2 plasmid using the RealTime-Glo™ Annexin V Apoptosis and Necrosis Assay kit from Promega. The cells were maintained in high glucose DMEM medium supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... The RSB/RNasin buffer (2 ml) was prepared fresh and contained 200 ul of 10 X RSB and 50 ul RNasin (N2511, Promega, USA). The PEB buffer (10 ml ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative RT-PCR (qPCR) reactions were conducted in a 10-µL total volume using a 2× GoTaq® qPCR Master Mix (Promega) and run on an ABI 7500 qPCR thermocycler (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: The first step to generate the probe was to amplify the RdRp gene target from SARS-CoV-2 cDNA using GoTaq® DNA Polymerase PCR kit (Promega) and the following oligonucleotide primers RdRp Fwd 5’-AACACGCAAATTAATGCCTGTCTG 3’ and RpRd Rev 5’ GTAACAGCATCAGGTGAAGAAACA 3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... on-bead digestions were done with 2 µg LysC (Wako chemicals 125-05061) in 4 M urea and 4 µg trypsin (Promega ADV5113) in 1.2 M urea sequentially before quenching with 1% formic acid ...
-
bioRxiv - Neuroscience 2022Quote: ... astrocytes were collected and processed after a 2-hour incubation period to determine intracellular glutamate levels using the Glutamate-Glo™ Assay (Promega) according to manufacturer’s instructions ...
-
bioRxiv - Zoology 2019Quote: ... Traces of genomic DNA were removed by treating 2 μg of the total RNA with RQ1 RNase-Free DNase (Promega, USA). First-strand cDNA was synthesised from RNA using the M-MLV reverse transcriptase (Promega ...
-
bioRxiv - Cancer Biology 2019Quote: ... CC-122 or DMSO and live cell numbers were measured every 2 days using the Cell Titer Glo 2.0 kit (Promega, Madison, WI). At each time point ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary MEFs were immortalised by transfection of 2 μg of simian virus 40 large T-antigen-expressing vector employing Fugene 6 Transfection Reagent (Promega, E2311) followed by five rounds of a 1 in10 split to achieve 1/100,000-fold splitting ...
-
bioRxiv - Molecular Biology 2020Quote: ... cell pellets were lysed in polysome lysis buffer (gradient buffer containing 100 mM KCl, 10 mM MgCl2, 0.1% NP-40, 2 mM DTT, and 40 U/ml RNasin; Promega, Leiden, Netherlands), and onto 17–50% sucrose gradients and ultracentrifuged for 2 h at 40,000 rpm ...
-
bioRxiv - Systems Biology 2020Quote: ... we cloned synthetic fragments of HERV DNA (sequences in Table S8) using gBlocks® (Integrated DNA Technologies) into psiCHECK-2 (Promega). The fragments were inserted downstream of the Renilla luciferase gene using XhoI and NotI restriction sites and DNA ligation ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was extracted from a pellet of CRC cells (2×106 cells) using Maxwell® RSC miRNA Tissue Kit (AS1460, Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... the final volume was brought to 80 ml with Lysis Buffer+2 mM CaCl2 and incubated with 1000U of RQ1 DNase (Promega-PRM6101) for 30min at RT ...
-
bioRxiv - Genomics 2021Quote: ... 23.5 μl PCR master mix (20 μl Buffer 5X, 2 μl dNTPs 10 μM, 1.5 μl GoTaq; Promega, cat. no. M3001), and 5 μl of Forward universal primer ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... HEK293T cells were transiently transfected using Lipofectamine 2000 with 50 ng each of GLP-1R-SmBit and LgBit-β-arrestin-2 (Promega) diluted in pcDNA3.1 ...
-
bioRxiv - Microbiology 2022Quote: Various KSHV mRNA 5’-UTRs containing uORFs were cloned up stream of the Renilla luciferase gene in a psiCHECK™-2 vector (Promega) using a Gibson Assembly® Cloning Kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... 2 × 106 cells of each strain were mixed completely with equal volumes of the BacTiter-Glo reagent (Promega Corporation, Madison, WI), followed by incubation at room temperature for 15 min in the dark ...
-
bioRxiv - Molecular Biology 2023Quote: ... phosphorothioated and phosphorylated/phosphorothioated forward primers as well as a phosphorylated reverse primer were done in qPCR reaction mixtures including 1X reaction mixture of GoTaq 2-Step RT-qPCR kit (Promega, USA), 400 nM forward and reverse primers and in final volume of 20 μL ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were incubated at 30 °C and luminescence was quantified after 2 h and 4 h post infection (20 μl sample plus 20 μl substrate, Nano-Glo® Luciferase Assay System, Promega). The sample was carefully removed from the upper part of the tube without disturbing the sedimented erythrocytes in the blood samples.
-
bioRxiv - Immunology 2023Quote: ... reverse primer – GCTTCATCTCAACCTCCGTC) using genomic DNA from monocytes and ligated in dual luciferase reporter vector psiCHECK-2 downstream of Renilla luciferase (Promega Corporation) vector in Xho1 and Not1 sites in MCS ...
-
bioRxiv - Biophysics 2023Quote: ... transfection was carried out by adding 2 μg of freshly prepared bacmid DNA and 6 μL of FuGene HD transfection reagent (Promega, E2311), following the instructions provided by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μL of furimazine substrate was added to the reaction well from a working reagent stock of a 2:100 NanoDLR Stop & Glo Substrate to Buffer ratio (Promega #N1610). A total well volume of approximately 112.5 μL was incubated at room temperature for 2 minutes prior to measuring luminescence and OD600 readings on an EnVision plate reader (PerkinElmer).
-
bioRxiv - Cell Biology 2023Quote: ... the 200k pellets were digested for 2 h at 37°C with 0.4 µg of Trypsin/Lys-C (Promega CAT#: V5071) and then overnight by adding 0.4 µg of Trypsin/Lys-C ...
-
bioRxiv - Genetics 2023Quote: ... After adding 2 µg MS grade trypsin in the intraspecific hybrids (Pierce Biotechnology, Waltham, MA) and polyploids (Promega Corporation, Madison, WI) to each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 µg of bacmid DNA were used to transfect Sf21 cells for baculovirus generation using FuGENE® transfection reagent (Promega). The protein was expressed in Lonza Insect-EXPRESS™ medium for 72-96 h ...