Labshake search
Citations for Promega :
751 - 800 of 3411 citations for 7 CHLORO 1 METHYL 1H PYRAZOLO 4 3 B PYRIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... and then resuspended in 4 ml DMEM/F12 + 80 μl DNase (1U/μl) (Promega M6101). The DNase solution was gently shaken by hand for 2–5 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gel pieces were rehydrated in a mixture of 4 ng/µL trypsin (Promega, Madison, WI) and 0.01% ProteaseMAX (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by a 4 times dilution in Tris buffer and an overnight trypsin digestion (Promega) at a ratio 1/100 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Resuspended grindate was incubated (4°C, 20 min) with 660 U of DNase I (Promega). Insoluble cell debris was pelleted by spinning (16,000 g ...
-
bioRxiv - Cell Biology 2020Quote: ... Cultures were then incubated overnight at 4°C with either anti-β3-tubulin (Promega #G712A) or anti-Oct4 (Santa Cruz Biotechnologies #SC-5279 ...
-
bioRxiv - Systems Biology 2019Quote: ... samples were diluted with 4 volumes of Digestion Buffer (50 mM NH4HCO3) and trypsin (Promega) was added at a ratio of 1:50 ...
-
bioRxiv - Systems Biology 2019Quote: ... samples were diluted with 4 volumes of Digestion Buffer (50 mM NH4HCO3) and trypsin (Promega) was added at a ratio of 1:50 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein samples were digested using 4 μg of trypsin (sequencing grade, low autolysis trypsin; Promega), at 37 °C for 16 h ...
-
bioRxiv - Genetics 2022Quote: ... cells were transfected with L1 reporter constructs using 4 μl FuGENE HD transfection reagent (Promega), 96 μl Opti-MEM (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... 200 ml of media was treated with 4 U of RQ1 RNase-free DNase (Promega) for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Fisher) containing 4% FBS with or without HaloTag NanoBRET 618 Ligand (Cat. No. PRN1662, Promega) and incubated overnight at 37 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
HIVtat Alters Epithelial Differentiation State and Increases HPV16 Infectivity in Oral KeratinocytesbioRxiv - Microbiology 2023Quote: ... 200 ml of media was treated with 4 U of RQ1 RNase-free DNase (Promega) for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA (4 μg) was reverse-transcribed using oligo-dT and the Reverse Transcription System (Promega). cDNA samples were diluted 1:10 and 5 μl of each sample were used for PCR reactions (final volume of 20 μl ...
-
bioRxiv - Biochemistry 2023Quote: ... The pellet was resuspended in 4 M urea containing 0.1 % Protease Max (Promega Corp. V2071) and diluted in 40 mM ammonium bicarbonate buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... 4 hours incubation at 37 °C) and 5 μg of trypsin (Trypsin Gold from Promega, in 50 mM TEAB pH 8.5 ...
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Genomics 2019Quote: ... Alternatively, ¼ of an agarose plug was soaked in GET solution (3% 2-mercaptoethanol, 0.5x QuantiFluor® dye (Promega), 1X TBE ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Molecular Biology 2020Quote: Cell viability was assayed with an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) colorimetric assay (Promega) per manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 3 µM PP242 for 2 h and lysed with Passive Lysis Buffer (Promega, E194A). Luminescence was detected with a Dual- Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were examined for viability every 4 to 6 weeks with the CellTiter-Glo assay (Promega). Cell viability was measured in quadruplicates by seeding the cells (2,000 to 3,000 per well in 96-well plate) ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NUMB1-4 (from V.O.R.) expression plasmids was performed using FuGENE HD transfection reagent (Promega, E2311) according to the manufacturer’s protocol and selected with Geneticin (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viability was measured every 4 days using the CellTiter-Glo luminescent cell viability assay (Promega G7573). A D300e drug dispenser (Tecan ...
-
bioRxiv - Plant Biology 2022Quote: ... and GST- GBF3 were purified from 4 ml culture and immobilized on MagneGST Glutathione particles (Promega). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... then transfected with 4 μg pLZRS-GCaMP6 DNA plus 12 μl FuGENE 6 (Promega Cat. #E2691) in 800 μl of Opti-MEM (Thermo-Fisher Cat ...
-
bioRxiv - Microbiology 2023Quote: ... then digested with 4 μL of a trypsin/Lys-C Mix (0.5 μg/uL) (Promega # V5071) using a two-step in-solution digestion overnight at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... HRP (4 μM) was added followed by 20 μL of Nano-glo luciferase substrate (Promega, N1110) to each well ...
-
bioRxiv - Genomics 2021Quote: ... 1 U μl−1 RNasein (Promega), 0.1% IGEPAL CA-630 (Sigma)) ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Genomics 2020Quote: ... 3 ug of pCAG-NLS-Bxb1 was diluted in 250 uL of OptiMEM and 6 uL of Fugene (Promega). On day 2 ...
-
bioRxiv - Cell Biology 2019Quote: ... nuclei from HepG2 cells were isolated by incubating cell pellets in 500 μl of a hypotonic buffer for 15 min on ice (20 mM Tris-HCL, pH 7.4, 10 mM NaCl, 3 mM MgCL2, with protease and phosphatase inhibitor cocktail from Promega). Triton X-100 detergent was added to a 0.5% v:v final concentration to lyse the cells followed by centrifugation at 1200 × g for 10 min to pellet nuclei ...
-
bioRxiv - Genetics 2021Quote: ... 2-3 μl of the clear part of the solution was used for PCR with either Gotaq (Promega, M7808) or LongAmp 2X (NEB ...
-
bioRxiv - Cell Biology 2021Quote: ... fumigatus pyrGAf gene and 870 nucleotides of the myoE 3’-UTR region was cloned in pGEM-T easy (Promega). This plasmid was used as template for site-directed mutagenesis (QuickChange kit ...
-
bioRxiv - Genomics 2021Quote: ... Variant or variant haplotype fragments were amplified in African American heterozygous individuals carrying the variants of interest located in the middle of the fragments (Supplementary Table 2 and 3) and cloned into the enhancer reporter vector pGL4.24 (E8421, Promega). Subsequently ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild-type and mutant MMP2 3′-UTRs were synthesized and recombined into pmirGLO Luciferase vectors (Promega, Madison, WI, USA). Then pmirGLO-Wt/pmirGLO-Mt or miR-1299 mimics/miR-NCs were co-transfected into EC9706/KYSE30 cells ...
-
bioRxiv - Genomics 2022Quote: Cell viability upon siRNA transfection was measured through the CellTiter 96® Non-Radioactive Cell Proliferation Assay (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT)) (Promega). 1× 104 microglia cells were plated per well in a 96 well plate and transfected with either ON-TARGETplus Non-targeting Control siRNA (Horizon Discovery) ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...