Labshake search
Citations for Promega :
751 - 800 of 5048 citations for 6 Chloro 2 3 4 9 tetrahydro 1H pyrido 3 4 b indol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... the blots were incubated for 1h with secondary antibodies (mouse antirabbit IgG-HRP, Promega W4018) that was diluted 1:10000 in blocking buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... Briefly 70-90% confluent cells in 6-well plated were transfected with 1 µg CRISPR/Cas9 plasmids per well by using FuGENE 6 (Promega, Madison, Wisconsin). After 24 h post-transfection ...
-
bioRxiv - Biochemistry 2019Quote: ... The Cyto-Tox ONE (Promega; LDH release from cells with damaged membranes ...
-
bioRxiv - Microbiology 2020Quote: ... RNAse One (50 U; Promega) and Benzonase (250 U ...
-
bioRxiv - Immunology 2021Quote: ... One-Glo-EX substrate (Promega) was added and incubated in the dark for 5 minutes ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 0.25 units RNase One (Promega) at 30 °C for 2 h ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Bioengineering 2023Quote: ... pucks (n=3) for each cell density condition underwent the BacTiter-Glo™ Microbial Cell Viability Assay (Promega), as described in the manufacturer’s instruction manual ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Biophysics 2020Quote: ... as well as expression construct of interest in a 9:8:1 mass ratio into HEK293T cells using FuGENE HD Transfection Reagent (Promega) per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... Stable cell lines were generated by co-transfecting pOG44 with pCDNA5/FRT/TO vectors encoding BRCA1 tBRCT (aa 1620-1862) in a 9:1 ratio using FuGENE HD transfection reagent (E2311, Promega). After 10 days of selection using Blasticidin (15μg/ml ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NUMB1-4 (from V.O.R.) expression plasmids was performed using FuGENE HD transfection reagent (Promega, E2311) according to the manufacturer’s protocol and selected with Geneticin (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viability was measured every 4 days using the CellTiter-Glo luminescent cell viability assay (Promega G7573). A D300e drug dispenser (Tecan ...
-
bioRxiv - Plant Biology 2022Quote: ... and GST- GBF3 were purified from 4 ml culture and immobilized on MagneGST Glutathione particles (Promega). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... then digested with 4 μL of a trypsin/Lys-C Mix (0.5 μg/uL) (Promega # V5071) using a two-step in-solution digestion overnight at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... HRP (4 μM) was added followed by 20 μL of Nano-glo luciferase substrate (Promega, N1110) to each well ...
-
bioRxiv - Microbiology 2022Quote: ... a one-fifth volume of CellTiter 96 AQueous One Solution Cell Proliferation Assay (G3580, Promega) was added to DMEM/Pen/Strep containing 2% FBS and incubated for 2 h ...
-
bioRxiv - Immunology 2022Quote: ... Caspase-Glo® 8 and Caspase-Glo® 9 (all Promega) kits were used as previously described (57) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 50mM Tris-HCl pH 9 and 2U DNAse (Promega, no. M6101). The virus was incubated for 10 min at room temperature and then centrifuged at 20,000xg ...
-
bioRxiv - Immunology 2020Quote: Viable cell numbers were quantified either by Trypan blue exclusion or by the production of formazan product (OD490) 2 hours after addition of CellTiter 96® Aqueous One Solution assay reagent (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: FuGENE 6 (Promega) was used to transfect RPE1 cells with plasmids for generating CRISPR/Cas9 knockouts ...
-
bioRxiv - Cell Biology 2021Quote: ... FuGENE 6 (Promega) transfection reagent was used according to the manufacturer’s instructions to transfect HeLa cells at a 3:1 ratio (using 1.5 μL FuGENE 6 and 0.5 μg DNA per well) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fugene 6 (Promega) was used to transfect 5 μg of vector into 100 mm plates of COS-7 cells ...
-
bioRxiv - Systems Biology 2021Quote: ... Fugene 6 (Promega) was used for transfection one day before imaging following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... FuGENE 6 (Promega) transfection reagent was used according to the manufacturer’s instructions to transfect at a 3:1 ratio (using 1.5 µL FuGENE 6 and 0.5 µg DNA per well) ...
-
bioRxiv - Cell Biology 2024Quote: ... FuGENE 6 (Promega) was used for all transfections according to the supplied protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Fugene 6 (Promega) or Fugene 4K (Promega ...
-
bioRxiv - Cancer Biology 2022Quote: ... to 10.5mL of 2.0 x 10^5 of Hek293 Cells (ATCC CRL1573) in growth media (DMEM + 10% FBS) was added 525uL of a 9:1 ratio of carrier DNA (Promega E4881) to a CLK nLuc construct-CLK1 CLK2 or CLK4 (Promega – NV1131 ...
-
bioRxiv - Cell Biology 2023Quote: HeLa FlpIn were co-transfected with pCDNA5 constructs with gene of interest and construct of pOG44 recombinase in a 1:9 ratio with Fugene HD (Promega, E2311) under the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Cell Biology 2019Quote: ... nuclei from HepG2 cells were isolated by incubating cell pellets in 500 μl of a hypotonic buffer for 15 min on ice (20 mM Tris-HCL, pH 7.4, 10 mM NaCl, 3 mM MgCL2, with protease and phosphatase inhibitor cocktail from Promega). Triton X-100 detergent was added to a 0.5% v:v final concentration to lyse the cells followed by centrifugation at 1200 × g for 10 min to pellet nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... fumigatus pyrGAf gene and 870 nucleotides of the myoE 3’-UTR region was cloned in pGEM-T easy (Promega). This plasmid was used as template for site-directed mutagenesis (QuickChange kit ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild-type and mutant MMP2 3′-UTRs were synthesized and recombined into pmirGLO Luciferase vectors (Promega, Madison, WI, USA). Then pmirGLO-Wt/pmirGLO-Mt or miR-1299 mimics/miR-NCs were co-transfected into EC9706/KYSE30 cells ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Immunology 2020Quote: ... pH 8.0 using Vivaspin columns (3 kDa) and digested separately O/N using trypsin or chymotrypsin (Mass Spectrometry Grade, Promega) at a ratio of 1:30 (w/w) ...