Labshake search
Citations for Promega :
701 - 750 of 1395 citations for Recombinant Human CTSZ Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... 100µg protein were digested in solution with RapiGestTM with 1 µg Trypsin (Promega) over night ...
-
bioRxiv - Systems Biology 2020Quote: ... Protein precipitation was performed by methanol-chloroform and proteolysis by trypsin/RapiGest (Promega Gold Grade ...
-
bioRxiv - Plant Biology 2019Quote: ... 100 μg of total protein was digested by Trypsin Gold (Promega, Madison, WI) with 1:100 w/w ratio at 37 °C for 18 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Proteins were digested with 0.4 μg of sequencing grade modified trypsin (Promega, #V5111) in 40 μl Hepes/NaOH ...
-
bioRxiv - Genomics 2021Quote: ... Proteins were digested by adding 0.2 µg of trypsin (Promega, Madison, WI, USA) per sample followed by incubation in 25 mM NH4HCO3 at 37°C overnight ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Proteins were digested with Lys-C (Wako Chemicals) and trypsin (Trypsin Gold, Promega).
-
bioRxiv - Plant Biology 2021Quote: ... Proteins were digested with trypsin (Sequencing Grade Modified Trypsin, Promega, Madison, WI, USA) at a 1:50 (trypsin:protein ...
-
bioRxiv - Plant Biology 2021Quote: ... The protein expression reaction was mixed with HaloTag-ligand conjugated magnetic beads (Promega) to pull down the HaloTag-fused TF ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: ... The proteins enriched by neutravidin beads were digested with MS-grade trypsin (Promega). The on-beads digested peptides were collected and desalted by the in-house prepared reversed phase C18 Stage-tip ...
-
bioRxiv - Biochemistry 2021Quote: ... Proteins were subjected to digestion using 20 µg sequencing grade Glu-C (Promega) in 1 M urea at 37°C overnight ...
-
bioRxiv - Cell Biology 2021Quote: ... HiBiT-fused proteins were visualized using the Nano-Glo HiBiT Blotting System (Promega). As an internal control of HiBiT proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... the bead-bound protein was incubated with 6.7 μM HaloTag-TMR ligand (Promega) for 15 minutes at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... and IgG captured and eluted from Magne Protein A beads (Promega, Madison, WI) as previously described (27 ...
-
Mitochondrial dysfunction rapidly modulates the abundance and thermal stability of cellular proteinsbioRxiv - Biochemistry 2022Quote: ... Proteins were digested with 0.4 μg of sequencing grade modified trypsin (Promega, #V5111) in 40 μl Hepes/NaOH ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Cell Biology 2022Quote: Proteins were digested from gels with 0.02 μg/μL modified porcine trypsin (Promega) after reduction with dithioerythritol and iodoacetamide ...
-
bioRxiv - Biophysics 2022Quote: ... Cleaved MSP protein was subsequently biotinylated using EZ-Link Maleimide-PEG11-Biotin (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... An equal number of proteins were digested with trypsin (Promega, Madison, WI, USA) at a ratio of 1:50 (w:w ...
-
bioRxiv - Neuroscience 2022Quote: ... the proteins were digested with 1.5 µg of Trypsin/Lys-C mix (Promega) for 16 h at 37°C (800 rpm) ...
-
bioRxiv - Cell Biology 2022Quote: The protein in the gel lanes were digested with 0.1 µg trypsin (Promega) in 20 µl 25 mM ammonium bicarbonate ...
-
bioRxiv - Cell Biology 2023Quote: ... the proteins were digested with 1 µg of trypsin/Lys-C mix (Promega) for 16 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Subsequent protein digestion was performed using Endoproteinase LysC and Trypsin (Ref.: V5071, Promega), diluted 1:25 (enzyme to protein ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were digested using a trypsin and lys-C mix (Promega, Madison, USA) at a ratio of 100:1 ...
-
bioRxiv - Systems Biology 2023Quote: ... Halo-fusion proteins were purified with Magne® HaloTag® Beads (Promega, USA) and then incubated with 50 ng ampDAP library ...
-
bioRxiv - Biophysics 2023Quote: Labeling reactions: Proteins with HaloTag were labeled with JF646-HaloTag ligand (Promega # GA1120) by incubating the proteins with a tenfold excess of dye on ice for 0.5-1 h in the presence of 1 mM ATP ...
-
bioRxiv - Systems Biology 2023Quote: ... The washed protein was then digested with trypsin (sequencing grade modified trypsin; Promega) in a mixture of 100 mM ammonium bicarbonate (pH 8 ...
-
bioRxiv - Biochemistry 2023Quote: ... In vitro protein synthesis by the coupled transcription and translation (TnT) system (Promega) was carried out in the presence of 35S methionine in either wheat germ or rabbit reticulocyte lysates ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were digested with 0.4 µg of sequencing grade modified trypsin (Promega, #V5111) in 40 µl Hepes/NaOH ...
-
bioRxiv - Biochemistry 2023Quote: ... RBD proteins in culture media were measured in Nano-Glo buffer (Promega N1110) supplemented with Nanoluciferase substrate and 11S protein according to the manual ...
-
bioRxiv - Cell Biology 2023Quote: ... Protein samples were then digested overnight at 37°C with Trypsin Gold (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and digestion of purified crosslinked protein with sequencing grade modified porcine trypsin (Promega), tryptic peptides were separated by reverse phase XSelect CSH C18 2.5 um resin (Waters ...
-
bioRxiv - Microbiology 2023Quote: ... HiBiT-tagged proteins were detected using the Nano-Glo HiBiT blotting system (Promega) according to the manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... Proteins were digested with Lys-C (Wako) and sequencing-grade trypsin (Promega, V5117) (1 μg of each in 20 μL of 50 mM TEAB ...
-
bioRxiv - Microbiology 2024Quote: ... Cleared protein extracts were incubated with 200 μl of MagneHis solution (Promega, USA) overnight ...
-
bioRxiv - Immunology 2024Quote: ... 5 mg purified RIPR protein fragment was incubated with TEV protease (Sigma/Promega) at a 1:10 v/v ratio overnight at 4 °C on a rolling mixer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were then in-gel proteolyzed using Sequencing grade modified porcine trypsin (Promega), and peptides were eluted (80% acetonitrile ...
-
bioRxiv - Microbiology 2023Quote: ... were digested with a modified MS grade trypsin (Promega; 1:5 enzyme/protein) overnight at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: ... Proteins were digested with 0.75 µg trypsin (Sequencing Grade Modified Trypsin, V5111, Promega) overnight at 37 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... African green monkey kidney (Vero) or human liver (HepG2) cells were performed via MTT assay using the CellTiter 96 Non-Radioactive Cell Proliferation (Promega) kit as previously described55 ...
-
bioRxiv - Molecular Biology 2021Quote: DRD1 Gs-mediated Gs-cAMP accumulation assays with HEK293T (ATCC CRL-11268) were performed using cells transiently expressing human DRD1 and the cAMP biosensor GloSensor-22F (Promega). Cells were seeded (20,000 cells/35 μL/well ...
-
bioRxiv - Biochemistry 2019Quote: JAK2-deficient ϒ2A human fibrosarcoma cells were transfected with different human JAK2-hemagglutinin (HA) constructs in pCIneo vector (100 ng per 12-well plate well) with FuGENE HD (Promega). After 48 hours ...
-
bioRxiv - Genetics 2019Quote: ... A cDNA encoding Myc epitope-tagged human TRAPα was synthesized by Integrated DNA Technologies (IDT) and was subcloned into the pTarget mammalian expressing vector (Promega).
-
bioRxiv - Physiology 2020Quote: The human HMGCS1 promoter was amplified (forward primer: GTCCATCGGAATTAGTTTAGCCTGTGC, reverse primer: CAATCGCGGCCGGTAGAGTTG) and cloned into the pGL3-Basic Vector (Promega). Full-length PTBP1 expression vector and control vector were purchased from OriGene (Cat ...
-
bioRxiv - Cancer Biology 2019Quote: The ADCC activity of KY1044 human IgG1 (produced at Kymab) was first tested in vitro using an ADCC reporter bioassay (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: 1μg of total RNA from the human and mouse brain specimen was reverse-transcribed using the M-MLV reverse transcriptase (Promega) for efficient synthesis of the first-strand cDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... and NanoLuc fused to the amino terminal 112 amino acids of human Phosducin circularly permutated at amino acids 54/55 (Promega). The NanoLuc/Phosducin fusion portion also contains a kRAS membrane targeting sequence at the carboxy terminal end ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... cells were transfected using a 1:3 ratio of human μOR and a splitluciferase based cAMP biosensor (pGloSensorTM-22F; Promega). Transit 2020 (Mirus Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total genomic DNA extracted from liver mouse and HEK293 cells were used as templates for PCR-cloning of the mouse/human promoter/intron fragments into the KpnI/MluI sites of pGL3 basic luciferase reporter vector (Promega). The glutamic acid (E ...
-
bioRxiv - Microbiology 2020Quote: ... incubating and chromogenic reaction generating were similar to the ACE2 assay instead of that primary antibody binding to antigen was not required and that HRP-conjugated goat anti-human IgG antibody (Promega) would be used as the secondary antibody to detect binding of CB6 antibody to the antigens.