Labshake search
Citations for Promega :
701 - 750 of 4905 citations for Plant DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... Total RNA was isolated from 30 mg of ground plant tissue using the SV Total RNA Isolation System Kit (Promega) and its concentration and integrity were assessed using the RNA 6000 Nano Kit on a Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Plant Biology 2024Quote: Total plant RNA was treated with DNase I (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: The amplified products underwent purification using Quick PCR purification columns (Promega, Madison, WI, USA) and were subsequently sequenced with the Big Dye Terminator Cycle Sequencing Ready Reaction Kit on an Applied Biosystems analyzer (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... total RNA was extracted using Maxwell® 16 Cell LEV Total RNA Purification Kits (Promega, US) and reversed transcribed into complementary DNA (cDNA ...
-
bioRxiv - Cancer Biology 2019Quote: ... Total RNA purification was performed using the kit SV total RNA isolation system (Promega, Fitchburg, USA). Purified total RNA was quantified using NanoDrop (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... homogenized and RNA was extracted using the Maxwell total RNA purification kit with DNAse treatment (Promega). cDNA was synthesized using the NZYtech first-strand cDNA synthesis kit with random primers and afterwards treated with RNAse ...
-
bioRxiv - Genomics 2021Quote: ... in a QIACube extractor or with Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega) in a Maxwell® RSC instrument following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: The Maxwell® RSC Viral Total Nucleic Acid Purification Kit (cat. # ASB1330, Promega Corporation, Maddison, WI) was used to isolate RNA as instructed by the manufacturer ...
-
bioRxiv - Biophysics 2023Quote: ... and extracted each from the gel using a standard protocol from PCR purification kit (Promega, A9282). We then mixed the three fragments together in 10 µl in molar ratio 1:2:1 ...
-
bioRxiv - Genomics 2023Quote: ... a column-based purification step was conducted with the kit SV total RNA isolation System (Promega). Extracted RNA integrity ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were treated with DNase post RNA extraction and purified using an RNA purification kit (Promega). RNA concentrations were assessed using a Nanodrop as well as a Qubit RNA analyzer for sample quality and RIN scores ...
-
bioRxiv - Cell Biology 2023Quote: ... NC cells and SC-differentiating spheroids was extracted with the 16 LEV simplyRNA Purification kit (Promega), following manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Genomic DNA was extracted with the DNA extraction IQ™ System kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2021Quote: ... DNA was extracted using the Wizard Genomic DNA Extraction Kit (Promega, Wisconsin, USA) and shipped on ice to the Wellcome Sanger Institute for sequencing using the Illumina platform as described previously 15 ...
-
bioRxiv - Neuroscience 2020Quote: Extracted DNA was quantified using Quantifluor double-stranded DNA kit (Promega Corporation, Australia) as per manufacturer instruction ...
-
bioRxiv - Immunology 2020Quote: ... DNA was isolated using a Maxwell® RSC Cultured Cells DNA Kit (Promega). Bisulfite modification of genomic DNA isolated from monocytes was performed using an EZ DNA Methylation-Gold™ Kit (Zymo Research) ...
-
bioRxiv - Genomics 2022Quote: ... Recombinant bacmid DNA was isolated using the SV genomic DNA isolation kit (Promega) using manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... DNA was isolated from these samples using a DNA cleanup kit (Promega Wizard).
-
bioRxiv - Immunology 2023Quote: ... Gene deletion was confirmed by DNA extraction (Wizard Genomic DNA Purif. Kit, Promega) and PCR amplification of target genes using BAIAP2L1 forward (GTCCCGGGGGCCCGA ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted using Maxwell® RSC Cultured Cells DNA kit (Promega, USA) and NexteraXT sequencing libraries were prepared following the manufacturer’s protocols (Illumina ...
-
bioRxiv - Genomics 2020Quote: ... Magnetic bead purification (Promega, NG2001) was employed for all changes in buffer conditions required for enzymatic reactions and for final buffer suitable for sequencing system ...
-
bioRxiv - Genomics 2019Quote: All plasmids used in this study were prepared from cultures grown overnight in LB using the Wizard Plus SV Minipreps DNA Purification System (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... was prepared from tachyzoites of RH or RH ΔKu80 (here referred as Δku80) strains using the Wizard SV genomic DNA purification (Promega) according to manufacturer’s instructions.
-
bioRxiv - Plant Biology 2019Quote: Total of RNA was extracted from various tissue of plants by using the Eastep®Super Total RNA Extraction Kit (Promega). The cDNA was synthesized from Dnase I treated total RNA using M-MLV 1st Strand Kit (Invitrogen) ...
-
bioRxiv - Plant Biology 2019Quote: ... Root tissue was ground in liquid nitrogen and total RNA was extracted with the Maxwell® 16 LEV plant RNA kit (Promega) in the Maxwell 16 AS2000 instrument (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... leaves and fruits were collected and in the field and total RNA was extracted with Maxwell® RSC Plant RNA Kit (Promega). Two pools were generated and used for PacBio Iso-Seq library preparation (Procedure & Checklist – Iso-Seq™ Express Template Preparation for Sequel® and Sequel II Systems ...
-
bioRxiv - Microbiology 2020Quote: Wizard Promega DNA extraction kits (Promega, Madison, WI) was used to extract DNA from overnight broth culture ...
-
bioRxiv - Microbiology 2019Quote: ... using the LEV DNA kit (AS1290, Promega, USA). Briefly ...
-
bioRxiv - Genetics 2019Quote: ... cleaned using the Wizard DNA cleanup kit (Promega) and desulfonated in 0.3M NaOH at 37°C for 30 minutes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and Promega DNA Clean and Prep Kit (Promega) in a custom DNA extraction protocol ...
-
bioRxiv - Genomics 2019Quote: Genomic DNA was extracted using the Wizard Genomic DNA Kit (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
Elizabethkingia anophelis response to iron stress: physiologic, genomic, and transcriptomic analysesbioRxiv - Microbiology 2019Quote: Genomic DNA was prepared using a genomic DNA extraction kit (Promega, Madison, WI, USA), and plasmid DNA was purified with the QIAprep spin miniprep kit (QIAGEN ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA was extracted using the Bacteria Genomic DNA Extraction Kit (Promega, United States) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Phage genomic DNA was extracted with a modified Wizard DNA Clean-Up kit (Promega) protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... genomic DNA was isolated using Wizard genomic DNA extraction kit (Promega, Cat No: A1120). For RNA isolation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Covalently closed circular (ccc) DNA was prepared by using a DNA extraction kit (Promega). The obtained cccDNA was purified by CsCl density gradient ultracentrifugation.
-
bioRxiv - Cancer Biology 2023Quote: ... Genomic DNAs were isolated using Maxwell® RSC Cultured Cells DNA Kit (Promega; AS1620) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... DNA was then purified using the Promega Wizard HMW DNA Extraction Kit (Promega A2920) and submitted for library preparation and sequencing.
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from leaves using the Maxwell® 16 Instrument LEV simplyRNA Purification Kits (Promega). All reverse transcription reactions were carried out using random primers and the High-capacity cDNA reverse transcription kit (Applied Biosystems®) ...
-
bioRxiv - Cancer Biology 2020Quote: ... The PCR product was run on the agarose gel and purified using PCR purification kit (A1222, Promega). The Alu PCR product was cloned into using pGEM-T Easy Vector (A1380 ...
-
bioRxiv - Microbiology 2020Quote: Genomic deoxyribonucleic acid (gDNA) was isolated from each mutant using the Wizard® gDNA purification kit (Promega). Illumina NextSeq was then performed by the Genomic Services Facility at Indiana University Center for Genomics and Bioinformatics ...
-
bioRxiv - Microbiology 2022Quote: ... The band was cut out of the gel and purified using the Wizard gel purification kit (Promega). Each purified fragment was cloned into the amplified and purified backbone with Gibson assembly 52 using reagents from New England Biolabs ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was extracted from roots using an RNA Purification kit as described by the manufacturer (Promega), followed by DNase I treatment ...
-
bioRxiv - Molecular Biology 2023Quote: ... RNA was extracted using the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Cat# AS1330, Promega) or Maxwell® RSC miRNA from Plasma or Serum (Cat# AS1680 ...
-
bioRxiv - Physiology 2024Quote: ... chow diet fed mice using Maxwell® 16 LEV simplyRNA Purification Kits (Catalog no. AS1280, Promega, USA). Reverse transcription was performed using a SuperScript™ IV First-Strand Synthesis System (Catalog no ...
-
bioRxiv - Molecular Biology 2020Quote: ... colonies that grow under ampicillin selection were tested by sequencing of the purified plasmid using Wizard Plus SV Minipreps DNA Purification (Promega; A1330). Primer used for the validation sequencing is TTAGGCAGGGATATTCACCA ...
-
bioRxiv - Genetics 2019Quote: ... the amplicons were purified from an agarose gel using the Wizard SV Genomic DNA Purification System (Promega Corp., Madison, WI, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... 4 × Promega Wizard® Minicolumns per replicate with a ratio of 0.5:1 virus concentrate to Wizard® PCR Preps DNA Purification Resin (Promega: A7170). The resultant extract was found to be inhibitory to all enzymatic reactions ...
-
bioRxiv - Genomics 2023Quote: ... with a higher binding capacity and cleaner eluate than traditional silica-based DNA purification systems (Sui, et al., 2020; Moeller, et al., 2014; Dunbar, et al., 2018; Promega, 2020). The platform also permits a high-throughput automated genomic DNA isolation from 48 samples in 40 minutes (Promega ...
-
bioRxiv - Bioengineering 2020Quote: ... amplicons from three PCR runs for each root sample were combined (Clement et al., 1998) and then purified using a PCR purification kit (PCR Clean-up Kit; PROMEGA Inc., Wisconsin, USA).