Labshake search
Citations for Promega :
701 - 750 of 5848 citations for Mouse Caprin 1 CAPRIN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... Per2E2-luc reporter gene was constructed by inserting the mouse Per2 promoter (−83 to +156 in reference to the Per2 TSS) into pGL4.12[luc2CP] (Promega), whereas Bmal1-luc was constructed by inserting the mouse Bmal1 promoter (−779 to +127 in reference to the Bmal1 TSS ...
-
bioRxiv - Cell Biology 2019Quote: ... was amplified from mouse genomic DNA and cloned upstream of luciferase cassette in KpnI/HindIII site of pGL4.23 (Promega) using primers listed in Supplementary table 1 ...
-
bioRxiv - Neuroscience 2022Quote: ... wherein the 3’ UTR of Prr7 (NM_0010302964) was amplified from mouse DNA and cloned into the pmiRGLO dual-luciferase expression vector (Promega). Mutations in miRNA binding sites conserved across mammals were introduced by site-directed mutagenesis using Pfu Plus! DNA Polymerase (Roboklon).
-
bioRxiv - Cell Biology 2022Quote: Total amounts of free cholesterol and cholesterol esters were determined in mouse islet lysates as per the manufacturer’s instructions (Promega). Phosphatidylserine levels were measured in mouse islet lysates as per the manufacturer’s instructions (LSBio).
-
bioRxiv - Cell Biology 2020Quote: ... Isolated RNA (500ng) was used for cDNA synthesis with mouse Maloney leukemia virus reverse transcriptase (Promega, Madison, WI, USA). SYBR Green RT-qPCR gene expression assays were performed in triplicate in an ABI StepOne Plus thermocycler using appropriate endogenous controls (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then incubated for 1h at room temperature with horseradish peroxidase-conjugated anti-mouse IgG secondary antibody (Promega) at 1:10,000 and peroxidase was detected using the Pierce chemiluminescence system (Pierce ...
-
bioRxiv - Neuroscience 2019Quote: ... and mouse Cbln2 E2 fragments were PCR-amplified from genomic DNA of individual species and inserted into pGL4.24 vector (Promega). The sequences of the PCR primers and synthetic oligonucleotides are listed in Supplementary Table 1.
-
bioRxiv - Genetics 2019Quote: ... genes were isolated from C57BL/6 mouse genomic DNA by standard PCR and inserted into the pGL4.10 vector (Promega).
-
bioRxiv - Neuroscience 2023Quote: ... A 9.5 kb fragment containing upstream promoter region of mouse Frizzled10 (Fzd10) gene was subcloned into pGEM vector (Promega). CreERT2gene (Feil et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... Secondary goat anti-mouse and anti-rabbit antibodies conjugated with alkaline phosphatase used for Western blots were from Promega.
-
bioRxiv - Plant Biology 2020Quote: ... cDNA was synthesized with the ImProm II Kit (Promega). qPCR was performed using the Brilliant III Ultra-Fast SYBR® Green QPCR Master mix reagents (Agilent Technologies ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized with a reverse-transcriptase kit (Promega). RNA of cells exposed to SARS-CoV-2 WT was isolated with the QIAamp Viral RNA Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... and LEV DNA kit (AS1290, Promega, Madison, WI, US). The filters with collected biomass in lysing matrix E tubes were incubated with 300μL of lysing buffer and 30μL of Proteinase K and incubated at 56°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... luciferase signal was quantified using the DualGlo kit (Promega). Each experiment was performed in triplicate with two biological replicates ...
-
bioRxiv - Molecular Biology 2021Quote: ... the Bactiter-Glo microbial cell viability assay kit (Promega) was used ...
-
bioRxiv - Molecular Biology 2020Quote: ... was subjected to poly(A)+tract isolation kit (Promega). Poly(A)+ enriched RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... According to the instructions of the detection kit (Promega), the cells were transfected with the luciferase reporter gene level plasmid ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was synthesized using the Reverse Transcription kit (Promega). Transcriptional levels of IFN-β ...
-
bioRxiv - Microbiology 2019Quote: ... followed by 350 μL RNA Dilution Buffer (Promega kit) were added to the cell suspensions ...
-
bioRxiv - Genomics 2019Quote: ... with a GoTaq® qPCR master mix kit (Promega). We used two technical replicates for each biological replicate ...
-
bioRxiv - Developmental Biology 2019Quote: ... Luminescence was measured following the kit protocol from Promega.
-
bioRxiv - Biochemistry 2020Quote: ... The pGEM-T Vector kit was purchased from Promega. Acrylamide/bisacrylamide (29:1 ...
-
bioRxiv - Microbiology 2019Quote: ATP was estimated using the BacTiter-Glo kit (Promega). For BDQ or INH treatments in MMA ...
-
bioRxiv - Cell Biology 2019Quote: ... and subsequently analyzed using the GoTaq Green kit (Promega) for analytical RT-PCRs with the primers listed in the Key Resources Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... Maxwell RSC DNA FFPE Kit (Promega Maxwell® RSC), PerkinElmer chemagic FFPE DNA kit (chemagic MSM 1 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... using the Wizard® Genomic DNA Purification Kit (Promega). The kit can be used for at least 100 isolations ...
-
bioRxiv - Genetics 2019Quote: ... using in situ DeadEnd Fluorometric detection kit (G3250-PROMEGA) according to technical protocol (#TB235) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the Maxwell 16 LEV Plant DNA Kit (Promega), with EcoR1 as the restriction enzyme for generating RAD-seq libraries ...
-
Cytoplasm localized ARID1B promotes oncogenesis in pancreatic cancer by activating RAF-ERK signalingbioRxiv - Cell Biology 2019Quote: Halo tag (Halo pulldown and labeling kit, Promega Corporations) and Streptavidin bead (GE Health care Bio-Science ...
-
bioRxiv - Cancer Biology 2019Quote: ... The dual luciferase assay kit (Promega, Madison, WI, USA) and Glomax 96 Microplate Spectrophotometer (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... Luciferase activity was measured by luciferase assay kit (Promega) using an LMaxII™ microplate luminometer (Molecular Devices) ...
-
bioRxiv - Cancer Biology 2021Quote: FGFR1 kinase enzyme system kit was purchased from Promega Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell lines were authenticated using the GenePrint10 kit (Promega) and matching to their original profiles (ATCC) ...
-
bioRxiv - Cell Biology 2021Quote: ... we used the CellTiter-Glo® Luminescent kit (Promega), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Neutralization was measured with a luciferase assay kit (Promega) and plotted relative to the value for control wells.
-
bioRxiv - Plant Biology 2020Quote: ... or Maxwell® 16 LEV Plant RNA Kit (Promega). cDNA was synthesized using Primescript II 1st Strand cDNA Synthesis Kit (Takara ...
-
bioRxiv - Plant Biology 2021Quote: ... using the Maxwell 16 LEV Plant RNA Kit (Promega). RNA was quantified using a NanoDrop (Thermo Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized using MMLV reverse transcriptase kit (Promega) according to the manufacturers’ protocol with random primers (Promega) ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted using the Wizard Kit (Promega), as stated above ...
-
bioRxiv - Microbiology 2021Quote: ... The Wizard genomic DNA purification kit (Promega, Madison, WI) was used for isolation of bacterial genomic DNA (gDNA) ...
-
bioRxiv - Cell Biology 2020Quote: A GenePrint 10 System PCR Amplification kit (Promega Corporation) was used to determine the genetic signature of both samples based on the multiplex analysis of 9 loci and the Amelogenin sex-determining marker ...
-
bioRxiv - Cancer Biology 2019Quote: ... Dual-luciferase reporter gene assay kit (Promega, Beijing, China) was used to measure activities of Luciferase ...
-
bioRxiv - Plant Biology 2022Quote: ... cDNA synthesised (AMV Reverse Transcriptase kit, Promega, Southampton, UK) and amplified with primers CUE8cDNA-F (CACCATGGCTAACGAAGAACTCAC ...
-
bioRxiv - Microbiology 2022Quote: ... with the Maxwell® RSC Blood DNA kit (Promega) according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2022Quote: Cell Titer Glo Luminescent Cell Viability Assay Kit (Promega) was used and subsequently performed after the BRET measurement ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was synthesized using the reverse transcription kit (Promega) and transcriptional expression of IFIT1 (Fw ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA synthesis was done with reverse transcription kit (Promega) using 50ng of total RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the Maxwell DNA LEV Blood Kit (Promega #AS1290) according to manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... purified using a Wizard Genomic DNA Purification kit (Promega), and sent for Sanger sequencing (ACGT) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Triglyceride-Glo™ Assay kit (Cat#J3160, Promega) from Promega were used according to user’s manual ...