Labshake search
Citations for Promega :
701 - 750 of 1764 citations for Dechlorane Plus Syn Bis Cyclopentene 13C10 99% 100 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... 100 ng/ul of Trypsin (Sequencing grade modified porcine trypsin, Promega) was prepared in 50 mM ABC and 5 ul of it added into the middle of the membrane piece ...
-
bioRxiv - Plant Biology 2023Quote: ... 40 µL of trypsin 1:100 (Sequencing grade modified trypsin, Promega) in 50 mM ammonium bicarbonate were added to the sample and incubated in a wet chamber at 37 °C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... pulsed for 20 min with 100 nM TMR ligand (Promega, G8251), washed twice in 1x DPBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... 100 µl/well of room temperature Caspase Glo 3/7 (Promega) reagent was added to the treated and control cells ...
-
bioRxiv - Cancer Biology 2024Quote: ... The 100 µL of cell culture lysis reagent (Promega, WI, USA) was added and suspended ...
-
bioRxiv - Microbiology 2024Quote: ... Subsequently Trypsin/LysC solution [100 ng/μL 1:1 Trypsin (Promega):LysC (FujiFilm ...
-
bioRxiv - Cell Biology 2024Quote: Samples were digested with trypsin to a 1:100 trypsin (Promega) to protein ratio for 15 h at 37°C with constant agitation ...
-
bioRxiv - Microbiology 2022Quote: ... 200 mL of the cell suspension was treated overnight with 80 μg/mL proteinase K (Promega) in 1x proteinase K digestion buffer (10mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2020Quote: ... colonies that grow under ampicillin selection were tested by sequencing of the purified plasmid using Wizard Plus SV Minipreps DNA Purification (Promega; A1330). Primer used for the validation sequencing is TTAGGCAGGGATATTCACCA ...
-
bioRxiv - Synthetic Biology 2019Quote: Liquid cultures of the transformed cells were used for plasmid extraction and purification using the Wizard® Plus SV Minipreps DNA Purification System kit (Promega). The plasmids quality and concentration were quantified using the Synergy HTX plate reader (BioTek ...
-
bioRxiv - Genomics 2020Quote: ... TRs were amplified using the forward and reverse primers plus an M13 primer with one of the four fluorophores with GoTaq polymerase (Promega #PRM7123) using PCR program ...
-
bioRxiv - Plant Biology 2019Quote: ... Kinase activity was measured as ATP consumption by addition of 50 µl of Kinase-Glo® Plus Reagents (Promega; Fitchburg, WI), 10 min incubation at 30°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The promoter and enhancer candidate regions of ROR1 were amplified by PCR using KOD -Plus- Neo (Toyobo, KOD-401) and subcloned into the pGL3 luciferase reporter vector (Promega, E1751) (Figure 6C) ...
-
bioRxiv - Microbiology 2022Quote: ... The samples were incubated at 30 °C and luminescence was quantified after 2 h and 4 h post infection (20 μl sample plus 20 μl substrate, Nano-Glo® Luciferase Assay System, Promega). The sample was carefully removed from the upper part of the tube without disturbing the sedimented erythrocytes in the blood samples.
-
bioRxiv - Genomics 2023Quote: ... TRs were amplified using the forward and reverse primers plus an M13 primer with one of the four fluorophores with GoTaq polymerase (Promega #PRM7123) using PCR program ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.2 mg/mL acetylated BSA (Promega), 0.02% NP-40 (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2019Quote: ... 1 mg/mL Proteinase K (Promega) with 0.5% SDS in DPBS at 40 °C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... 1 mg/mL Proteinase K (Promega) with 0.5% SDS in PBS at 40 °C overnight ...
-
bioRxiv - Microbiology 2019Quote: ... and 60U/ml RQ1 DNase (Promega). Gag was immunoprecipitated by incubating the cell lysates with HIV-Ig bound to DynabeadsTM Protein G (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... 20 U/mL RNasin (Promega # N2511), 10% sucrose ...
-
bioRxiv - Biochemistry 2021Quote: ... 200 µg/ml acetylated BSA (Promega), 0.01% P-20 surfactant (GE Healthcare) ...
-
bioRxiv - Biochemistry 2021Quote: ... 200 µg/ml acetylated BSA (Promega), 0.0025% P-20 surfactant (GE Healthcare) ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 1 unit/mL RNAsin (Promega)) at room temperature for 30 minutes (unless otherwise noted) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Following G418 selection (500μg/mL, Promega), positive clones were collected for somatic cell nuclear transfer ...
-
bioRxiv - Plant Biology 2023Quote: ... and 20 U/mL RNAsin (Promega) and incubated for 30 min with gentle rocking at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml FuGENE HD (Promega, E2312) transfection mix containing 30 μl FuGENE HD and 8 μl of each plasmid was prepared per plate ...
-
bioRxiv - Physiology 2023Quote: ... Trypsin solution (25µg/mL, Promega France), 20 mM ammonium bicarbonate and 0.01 % glycerol (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... 10 U/ml RQ1 DNase (Promega), 1 mM Chloramphenicol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20U/ml Rnase inhibitor (Rnasin, Promega), 1X Protease inhibitor cocktail (cOmplete ...
-
bioRxiv - Developmental Biology 2023Quote: ... 200 U/mL RNasin (#N2111, Promega), 100 µg/mL cycloheximide (#7698 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg/mL proteinase K (Promega)) and incubated overnight at 50°C ...
-
bioRxiv - Biochemistry 2024Quote: ... 1,000 U/ml RNase inhibitor (Promega), and 450 U/mL DNase I (Roche)) ...
-
bioRxiv - Microbiology 2021Quote: ... The reaction was quenched by adding 40 μl of 25 mM DTT and subsequently 5 μl of 100 mM CaCl2 and 25 µl of Trypsin stock was added (400 ng/μl Trypsin Platinum from Promega Corp. in 100 mM Tris-HCl [pH 8]) plus 115 μl of 25 mM NH4HCO3 (pH 8.5 ...
-
bioRxiv - Microbiology 2019Quote: ... infected cells were lysed in 100 μL BrightGlo Luciferase reagent (Promega #E2610) and read on a LUMIstar Omega Luminometer (settings ...
-
bioRxiv - Molecular Biology 2021Quote: ... 15 μL of 100× diluted furimazine (Nano-Glo luciferase assay reagent, Promega) was added to each well ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 μL of 100× diluted furimazine (Nano-Glo luciferase assay reagent, Promega) was added to each well ...
-
bioRxiv - Molecular Biology 2019Quote: ... 100 μL 40mM ABC containing 0.5 μL of trypsin gold (Promega, V528A) in PBS was added to each sample and samples were incubated overnight at 37°C in a closed ...
-
bioRxiv - Bioengineering 2019Quote: ... permeabilized with tris-buffered saline (TBS) containing 0.5% Triton X-100 (Promega), and blocked with AbDil (2 wt % bovine serum albumin (BSA ...
-
bioRxiv - Immunology 2020Quote: ... Luciferase activity was quantified using 100 μL of Luciferase Assay Reagent (Promega) as a substrate ...
-
bioRxiv - Microbiology 2019Quote: ... Transfected cells were harvested in 100 µl cell culture lysis reagent (Promega) and 60 µl supernatants were mixed with 25 µl 6mM beetle luciferin (Promega) ...
-
bioRxiv - Cell Biology 2021Quote: ... The remaining cells were lysed with 100 μl Passive Lysis Buffer (Promega) and incubated at room temperature for 15 min with constant agitation ...
-
bioRxiv - Neuroscience 2021Quote: ... Dual-Glo Stop & Glo Reagent diluted (1:100) in culture medium (Promega) was added to each well and the luminescence of the renilla luciferase was measured after 20 min incubation at RT ...
-
bioRxiv - Microbiology 2021Quote: ... the samples were diluted 1:100 in 1 × passive lysis buffer (Promega) and 5 µl were transferred into a white Nunc 96-well plate ...
-
bioRxiv - Microbiology 2020Quote: ... each reaction contained 20 μL of 100 ng of pGL3 plasmid (Promega), mixed with 100 ng Igf2 P3 Nluc (or empty vector or constructs obtained from Igf2 P3 Nluc) ...
-
bioRxiv - Cell Biology 2021Quote: ... containing 100 nM bafilomycin A1 and 37.5 nM TMRDirect Halo Ligand (Promega). After 2 hours in EBSS ...
-
bioRxiv - Microbiology 2022Quote: ... Cytotoxicity was measured by adding 100 μl of Cell titer glow (Promega) reagent and incubated for 15 minutes at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... A 100 µl aliquot of CellTiter-Glo® 2.0 Reagent (G924A, Promega) was added into the wells ...
-
bioRxiv - Plant Biology 2021Quote: ... Total protein was extracted using 100 μL of Passive Lysis Buffer (Promega). 20 μl of the supernatant were used to measure the LUC and RLUC activity using a Dual-Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... Pin1 knock down was induced by adding 100 μM IPTG (Promega, V395A) for 48 hours ...
-
bioRxiv - Microbiology 2021Quote: ... injected retro-orbitally with 100 μl of Nano-Glo luciferase substrate (Promega), and immediately imaged ...