Labshake search
Citations for Promega :
701 - 750 of 4030 citations for 7 BROMO 1 2 3 4 TETRAHYDROCYCLOPENTA B INDOLE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and the near full-length 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-TACGGTTACCTTGTTACGA-3’) with the GoTaq® Hot Start Colorless Master Mix (Promega Corp., Madison, WI, USA). PCR was performed using Eppendorf Vapo Protect Mastercycler Pro S 6325 (Hamburg ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cell viability was determined prior to gene expression studies on day 7 by measuring ATP release in supernatants with the CellTiter-Glo 3D assay (Promega, G9681) according to the manufacturer’s protocol to pre-specify appropriate testing ranges ...
-
bioRxiv - Cancer Biology 2021Quote: Apoptosis of cells cultured in vitro were assessed using a cleaved caspase3/7 activity kit following the manufacturer’s instructions (Promega, cat#8090). Briefly ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Plant Biology 2023Quote: ... The final pellet was dried at room temperature and resuspended in 500 µL of [7 M urea (Promega, Madison, WI, USA), 2 M thiourea (Sigma-Aldrich Corp. ...
-
bioRxiv - Biochemistry 2023Quote: The FASP method[7] was used to digest urine protein with trypsin (Trypsin Gold, Mass Spec Grade, Promega, Fitchburg, Wisconsin, USA). One hundred micrograms of urine protein was added in the membrane of a 10KD ultrafiltration tube (Pall ...
-
bioRxiv - Cancer Biology 2023Quote: ... cytotoxicity and apoptosis were measured 48h and 7 days after the knock-down using ApoTox-Glo triplex assay kit (Promega,G6320) according to manufacturer’s instructions.
-
bioRxiv - Plant Biology 2019Quote: ... An aliquot containing 4 μg RNA was treated for 45 min with 2 μl of DNase RQ1 (1 μg/μl) at 37 °C (Promega, UK), and purified using an RNAeasy spin column (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... Culture media was then replaced with 50 µL of qNSC/aNSC media containing 1 mM 2DG (2-deoxy-D-Glucose, provided in Glucose Uptake-Glo kit from Promega (J1342)) reagent for 10 minutes in incubator (humidified ...
-
bioRxiv - Cell Biology 2019Quote: ... cat # 129-02541) overnight at 37°C and then diluted 1/2 and digested with 0.9 µg of trypsin (Promega, cat # V5113) for eight hours at 37°C ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113).
-
bioRxiv - Cell Biology 2020Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Real-Time PCR Diagnostic Panel17 and a protocol for quantifying the SARS-CoV-2 subgenomic E gene RNA (E SgRNA)18 using the GoTaq® Probe 1-Step RT-qPCR System (Promega). For quantification of SARS-CoV-2 using the nCoV assay ...
-
bioRxiv - Biochemistry 2021Quote: ... and the “on-bead-digestion” plate (100 μl 20 mM Tris pH 8.5, Sigma-Aldrich 10708976001, 1 μg/mL LysC, Wako 129-02541, 2 μg/mL Trypsin, Promega V5111). The programmed sequence is ...
-
bioRxiv - Microbiology 2022Quote: ... then diluted 1:5 with nuclease-free water before 2 µL was used as template in a 10 µL GoTaq 1-Step RT-qPCR (Promega, A6020) reaction (69) ...
-
bioRxiv - Developmental Biology 2022Quote: ... for the duration of imaging (approximately 2 minutes per embryo) with the yolk supported in a shallow well of solidified 1% low-melting agarose (Promega, V2111). Adult fish were photographed using a Panasonic DMC GX7 camera with a Panasonic Lumix G 20mm pancake lens ...
-
bioRxiv - Synthetic Biology 2022Quote: To measure luciferase activity on plaque containing LB-agar plates, 5 μl of the diluted (1:50, in PBS) NanoLuc® luciferase substrate 2-furyl methyl-deoxy-coelenterazine (Furimazine; Promega) were dropped onto the respective plaques ...
-
bioRxiv - Immunology 2023Quote: ... and then diluted 2-fold with 200 mM ammonium bicarbonate for trypsin digestion (1:10 w:w, 37°C, 8h, Promega cat # V5113). After digestion ...
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 µL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 µL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Developmental Biology 2023Quote: ... Membranes were washed in TBST and probed with anti-mouse HRP secondary antibody (Promega; 1:5000 in 2% BSA in TBST) for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: The viral RNA derived from the lung and nasal turbinate samples was quantified using a protocol for quantifying the SARS-CoV-2 sub-genomic E gene RNA (sgE)29 using the GoTaq® Probe 1-Step RT-qPCR System (Promega).
-
bioRxiv - Genomics 2023Quote: ... The reaction was stopped with the addition of 150 μL IP Elution Buffer (1% SDS, 0.1 M NaHCO3) and 2 μL Proteinase K (Promega, Cat # MC5005), then incubated at 65 °C overnight to reverse crosslinks ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were then washed 3x with TBS-T and incubated for 2 hours at room temperature with either anti-rabbit (1:5000, Promega W4011) or anti-mouse HRP (1:5000 ...
-
bioRxiv - Immunology 2024Quote: ... mice were humanely killed by xylazine/ ketamine overdose and lungs inflated with 1 ml of 2% low melting temperature agarose (Promega, US) at 37 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μL of CellTiter-Glo® (Promega cat#: G7570) were added to each well and incubated for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Samples were washed and endogenous biotin was blocked using Avidin/Biotin blocking kit (Vector laboratories ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... We identified a common tracer probe (K-4, Promega), suitable for all mutants ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 4 µL FuGene HD (Promega), 1 µg sgRNA-Cas9 plasmid DNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 and exon 4 were cloned to pGL4.23 (Promega) upstream to the minimal promoter ...
-
bioRxiv - Biophysics 2022Quote: ... 4% glycerol with 12 units RNasin (Promega, Madison, WI), 10 μg/ml BSA ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of random primers (Promega) were added after which the mixture was incubated at 65 °C for 5 min ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2 μg of Trypsin (Promega, V5111) was added to each sample and they were incubated shaking at 37°C overnight (o/n) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.25 µl of 2% digitonin (Promega) and 0.5 µl of 10% Tween-20 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 U GoTaq Flexi Polymerase (Promega) and 0.22 µg TaqStart Antibody (Clontech) ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 μL Superasin RNase inhibitor (Promega), and 8 μL PEG8000 (supplied with ligase) ...
-
bioRxiv - Molecular Biology 2020Quote: The commercial psiCHECK™-2 (Promega) vector was modified by deleting the Rluc poly(A ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 U/μl RNaseIn Plus (Promega) and 10 U/μl SuperScript IV Reverse Transcriptase enzyme while heated ...
-
bioRxiv - Neuroscience 2022Quote: ... The psiCHECK-2 vector (Promega, C8021) was used to build the dual luciferase reporters with Kcnj10 UTRs ...
-
bioRxiv - Systems Biology 2022Quote: ... 2 µl trypsin (Promega Trypsin Gold) was added pre-diluted in ultra-pure water to 2 ng/µl and incubated overnight at 37°C in the thermal cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... The psiCHECK-2 vector (Promega, C8021) and the psiCHECK-RL-Ifnb1 3’ UTR vector were described before (Zhang et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... of selected 3’UTRs into the pmirGLO vector (Promega, Southampton, UK) was used to generate 3’UTR luciferase reporters essentially as previously described (9) ...
-
bioRxiv - Biochemistry 2020Quote: ... Each well was transfected with 3 uL FuGENE 6 reagent (Promega) and 130 ng pcDNA3-mouseSTING in line with manufacturer’s protocols.
-
bioRxiv - Microbiology 2021Quote: ... 3 μg of total RNA was treated with RQ1 DNase (Promega), and then purified by phenol chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cell Biology 2020Quote: ... or 250 ng DNA (Nup54-mEGFP) and 3 µL FuGENE6 (Promega) in Opti-Mem I (Gibco ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Samples from liquid culture were placed on 3% agarose pads (Promega) containing M9 minimal media and sandwiched between glass coverslips to immobilize the cells for imaging ...