Labshake search
Citations for Promega :
701 - 750 of 1285 citations for 5 Isoxazolemethanol 3 3 fluorophenyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... or mCherry were amplified by PCR (5’-CCGGGTACCATGGGCAGCAGCCATCATC and 5’-CGGGAATTCTTACTTGTACAGCTCGTCCAT primers; Pfu DNA polymerase, Promega) from the pRGrectac-NHis constructions (Fernández-Tresguerres et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... 5 units GoTaq DNA polymerase (Promega) and water to 50μl ...
-
bioRxiv - Neuroscience 2022Quote: ... 5 μL ADP-Glo reagent (Promega) was added to each reaction mixture and incubated for 40 min at 25°C ...
-
bioRxiv - Biochemistry 2020Quote: ... and 5 µL RNasin Plus (Promega) per sample to 800 µL lysate and 1.5-2 hours of rotation at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μM HaloTag-TMR ligand (Promega), Ready-Lyse Lysozyme (47 U/μl ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of CTG reagent (Promega G7571 ...
-
bioRxiv - Immunology 2023Quote: ... 5 ng of pRL-TK (Promega), and 5 ng of pEF-Slc46 expression plasmid using GeneJuice (Millipore ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg/mL proteinase K (Promega)) and incubated overnight at 50°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 μl of CellTiter-Blue (Promega) was added and cells were incubated for 90 minutes at 37°C before measuring fluorescence using an EnVision plate reader (PerkinElmer) ...
-
bioRxiv - Immunology 2019Quote: ... BRET1 between hRLuc8 and mVenus was measured 5 min after addition of 5 µM coelenterazine H (Promega). BRET1 readings were collected using a Mithras LB940 reader (Berthold) ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells were pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Biochemistry 2021Quote: ... and then cells are pre-incubated 5 minutes at 37°C with 5 μM coelenterazine h (Promega) before adding ligands diluted in PBS supplemented with 0.9 mM CaCl2 and 0.5 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The 5’ UTR of mouse 5’-tRFCys targets or non-target Gapdh were cloned into psiCHECK2 (Promega). Synthetic 5’-tRF-Cys antisense or a scrambled control sequence embedded in the tough decoy backbone (Haraguchi et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 ng of pRL-SV40 (Promega) Renilla luciferase construct was added to the 384-well reporter library plates and incubated for 20 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... NanoBRET Tracer 5 (Promega, Madison, WI, USA) was used at a final concentration of 1.0 μM as previously evaluated in a titration experiment ...
-
bioRxiv - Molecular Biology 2021Quote: ... and HaloTag TMR Ligand (5 mM) (Promega) were dissolved in DMSO (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 μM HaloTag-TMR substrate (Promega) and incubated for 15 min at 37 °C with shaking ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 units RNasin Plus RNase inhibitor (Promega) as described (Lee et al. ...
-
bioRxiv - Systems Biology 2020Quote: ... 5 µg of K562 cell lysate (Promega) or 5 µg yeast digests were injected and run on a nanoAcquity UPLC (Waters ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 5 % BrightGlo (Promega, Madison, WI, USA) before reading luminescence on a Molecular Devices SpectraMax iD5 with a 1 second integration time ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 μg of trypsin (Promega, Sequence Grade) was added and digestion was performed overnight at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... Trypsin (5 μg/ml trypsin gold (Promega) in 25 mM ammonium bicarbonate ...
-
bioRxiv - Biochemistry 2021Quote: ... 4.0 µL of 5× GoTaq Buffer (Promega), 2.0 µL of MgCl2 ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μl of MgCl2 (25mM ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μL of buffer (5x, Promega®), 1.5 μL of MgCl2 (25 mM ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 µL GoTaq polymerase buffer 5x (Promega), 0.5 μL of each primer ...
-
bioRxiv - Neuroscience 2019Quote: ... and incubated 5 minutes with AttoPhos (Promega). Images were acquired with a FLA-5000 fluorescent image analyzer (Fujifilm ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 units RNasin Plus RNase inhibitor (Promega) as described (Lee et al ...
-
bioRxiv - Biochemistry 2020Quote: ... or 5:1 (w/w) Elastase (Promega), using manufacturer recommended temperatures for 18 h with 600 rpm shaking ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 5% pRL-TK Luc (Promega E2241) plasmid and 100 µL of the transfected cell suspension were seeded into a white PDL-coated 96-well flat bottom plate (Nunc) ...
-
bioRxiv - Biophysics 2023Quote: ... 5 μL of HiBiT lytic reagent (Promega N3040 ...
-
bioRxiv - Systems Biology 2023Quote: ... and 5 μg/mL Trypsin (Promega:487603)) for 1 hour at 25°C on a shaker (1000 rpm) ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 µL of ADP Glo Reagent (Promega), supplemented with 0.01% Triton X-100 ...
-
bioRxiv - Genetics 2023Quote: ... and 5 μl of TransFast (Promega; E2431) in a serum-containing medium in a total volume of 500 μl and plated into one well of a 24-well plate ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µL of 2x GoTaq (Promega, #A600A), 0,4 µL forward primer (0,5 µM) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM UDP-glucose (UDP-Glc, Promega), 20 mM MgCl2 and 30 mΜ cyclic-di-GMP (Sigma) ...
-
bioRxiv - Physiology 2024Quote: ... (Promega #E1941, diluted 1:5 with water). Dual-Glo Luciferase assays were performed to measure Firefly and Renilla luciferase activity (Promega #E2940) ...
-
bioRxiv - Microbiology 2024Quote: ... 5 µl 5x optimized transcription buffer (Promega), 2 µl T7 RNA polymerase (20 U.ml-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Plant Biology 2019Quote: ... 5 μL of 5× Green GoTaq® Flexi Buffer and 0.25 μL of 5U GoTaq® DNA Polymerase (Promega, USA) in a total volume of 25 μL ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5 µg/ml RNAsin (Promega, Cat#: N2511). The cells were collected through scraping and homogenised by pipetting ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 ng/μl of sequencing-grad trypsin (Promega) was added and proteins digested overnight at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL/mL RNasin Plus (Promega, cat. #N2611) was added 10 minutes before use ...
-
bioRxiv - Neuroscience 2020Quote: ... and 5 ng of Renilla luciferase report (Promega) were co-transfected into U87 human primary glioblastma cells by using ESCORT V transfection reagent (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 ng of pGL4.53(luc2/PGK) vector (Promega), 1 ng of pNL plasmid ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 μL Pfu DNA Polymerase 10X Buffer (Promega), 1 μL Pfu DNA Polymerase (Promega) ...
-
bioRxiv - Molecular Biology 2019Quote: ... supplemented with 5 μL RNase inhibitor (Promega # N2615), 100 μL 5X reaction buffer (750 mM NaCl ...